ID: 944743632

View in Genome Browser
Species Human (GRCh38)
Location 2:202635220-202635242
Sequence CACGCCGGCCGGCTCCCTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743623_944743632 4 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
944743619_944743632 11 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
944743615_944743632 27 Left 944743615 2:202635170-202635192 CCGGGGAGGGGGGGGACCATGTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72
944743621_944743632 5 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743632 2:202635220-202635242 CACGCCGGCCGGCTCCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743632 Original CRISPR CACGCCGGCCGGCTCCCTTG GGG Exonic