ID: 944743633

View in Genome Browser
Species Human (GRCh38)
Location 2:202635221-202635243
Sequence ACGCCGGCCGGCTCCCTTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743623_944743633 5 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
944743615_944743633 28 Left 944743615 2:202635170-202635192 CCGGGGAGGGGGGGGACCATGTC 0: 1
1: 0
2: 1
3: 14
4: 223
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
944743621_944743633 6 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
944743619_944743633 12 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743633 2:202635221-202635243 ACGCCGGCCGGCTCCCTTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743633 Original CRISPR ACGCCGGCCGGCTCCCTTGG GGG Exonic