ID: 944743635

View in Genome Browser
Species Human (GRCh38)
Location 2:202635224-202635246
Sequence CCGGCCGGCTCCCTTGGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743621_944743635 9 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743635 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 123
944743619_944743635 15 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743635 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 123
944743623_944743635 8 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743635 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743635 Original CRISPR CCGGCCGGCTCCCTTGGGGG TGG Exonic