ID: 944743637

View in Genome Browser
Species Human (GRCh38)
Location 2:202635229-202635251
Sequence CGGCTCCCTTGGGGGTGGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743626_944743637 -10 Left 944743626 2:202635216-202635238 CCCCCACGCCGGCCGGCTCCCTT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251
944743623_944743637 13 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251
944743619_944743637 20 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251
944743621_944743637 14 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743637 2:202635229-202635251 CGGCTCCCTTGGGGGTGGTGCGG 0: 1
1: 0
2: 0
3: 21
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743637 Original CRISPR CGGCTCCCTTGGGGGTGGTG CGG Exonic