ID: 944743638

View in Genome Browser
Species Human (GRCh38)
Location 2:202635232-202635254
Sequence CTCCCTTGGGGGTGGTGCGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 268}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743627_944743638 -8 Left 944743627 2:202635217-202635239 CCCCACGCCGGCCGGCTCCCTTG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743621_944743638 17 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743623_944743638 16 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743619_944743638 23 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743628_944743638 -9 Left 944743628 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743630_944743638 -10 Left 944743630 2:202635219-202635241 CCACGCCGGCCGGCTCCCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 146
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268
944743626_944743638 -7 Left 944743626 2:202635216-202635238 CCCCCACGCCGGCCGGCTCCCTT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 944743638 2:202635232-202635254 CTCCCTTGGGGGTGGTGCGGTGG 0: 1
1: 0
2: 1
3: 29
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743638 Original CRISPR CTCCCTTGGGGGTGGTGCGG TGG Exonic