ID: 944743641

View in Genome Browser
Species Human (GRCh38)
Location 2:202635238-202635260
Sequence TGGGGGTGGTGCGGTGGCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 12, 3: 53, 4: 640}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743621_944743641 23 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743634_944743641 -9 Left 944743634 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 177
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743627_944743641 -2 Left 944743627 2:202635217-202635239 CCCCACGCCGGCCGGCTCCCTTG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743623_944743641 22 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743619_944743641 29 Left 944743619 2:202635186-202635208 CCATGTCCCAGCGGGTGAGGCGC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743630_944743641 -4 Left 944743630 2:202635219-202635241 CCACGCCGGCCGGCTCCCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 146
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743626_944743641 -1 Left 944743626 2:202635216-202635238 CCCCCACGCCGGCCGGCTCCCTT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640
944743628_944743641 -3 Left 944743628 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 944743641 2:202635238-202635260 TGGGGGTGGTGCGGTGGCCACGG 0: 1
1: 0
2: 12
3: 53
4: 640

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743641 Original CRISPR TGGGGGTGGTGCGGTGGCCA CGG Exonic