ID: 944743645

View in Genome Browser
Species Human (GRCh38)
Location 2:202635245-202635267
Sequence GGTGCGGTGGCCACGGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 247}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944743636_944743645 -6 Left 944743636 2:202635228-202635250 CCGGCTCCCTTGGGGGTGGTGCG 0: 1
1: 0
2: 1
3: 10
4: 144
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743630_944743645 3 Left 944743630 2:202635219-202635241 CCACGCCGGCCGGCTCCCTTGGG 0: 1
1: 0
2: 1
3: 9
4: 146
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743626_944743645 6 Left 944743626 2:202635216-202635238 CCCCCACGCCGGCCGGCTCCCTT 0: 1
1: 0
2: 0
3: 15
4: 185
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743621_944743645 30 Left 944743621 2:202635192-202635214 CCCAGCGGGTGAGGCGCAATGGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743628_944743645 4 Left 944743628 2:202635218-202635240 CCCACGCCGGCCGGCTCCCTTGG 0: 1
1: 0
2: 1
3: 4
4: 73
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743634_944743645 -2 Left 944743634 2:202635224-202635246 CCGGCCGGCTCCCTTGGGGGTGG 0: 1
1: 0
2: 2
3: 16
4: 177
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743623_944743645 29 Left 944743623 2:202635193-202635215 CCAGCGGGTGAGGCGCAATGGGT 0: 1
1: 0
2: 0
3: 2
4: 33
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247
944743627_944743645 5 Left 944743627 2:202635217-202635239 CCCCACGCCGGCCGGCTCCCTTG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 944743645 2:202635245-202635267 GGTGCGGTGGCCACGGCCGGGGG 0: 1
1: 0
2: 1
3: 15
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944743645 Original CRISPR GGTGCGGTGGCCACGGCCGG GGG Exonic