ID: 944744801

View in Genome Browser
Species Human (GRCh38)
Location 2:202644650-202644672
Sequence CACTGAAGATATTCAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944744801_944744804 5 Left 944744801 2:202644650-202644672 CCAGACCTTGAATATCTTCAGTG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 944744804 2:202644678-202644700 TTTATACTTGCCGGTTTGACTGG 0: 1
1: 0
2: 0
3: 4
4: 114
944744801_944744803 -4 Left 944744801 2:202644650-202644672 CCAGACCTTGAATATCTTCAGTG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 944744803 2:202644669-202644691 AGTGATGTCTTTATACTTGCCGG 0: 1
1: 0
2: 1
3: 11
4: 130
944744801_944744807 26 Left 944744801 2:202644650-202644672 CCAGACCTTGAATATCTTCAGTG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 944744807 2:202644699-202644721 GGGTATAGAATTAGAATTGTAGG 0: 1
1: 0
2: 1
3: 17
4: 163
944744801_944744808 30 Left 944744801 2:202644650-202644672 CCAGACCTTGAATATCTTCAGTG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 944744808 2:202644703-202644725 ATAGAATTAGAATTGTAGGTTGG 0: 1
1: 0
2: 2
3: 22
4: 274
944744801_944744805 6 Left 944744801 2:202644650-202644672 CCAGACCTTGAATATCTTCAGTG 0: 1
1: 0
2: 0
3: 19
4: 144
Right 944744805 2:202644679-202644701 TTATACTTGCCGGTTTGACTGGG 0: 1
1: 0
2: 0
3: 2
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944744801 Original CRISPR CACTGAAGATATTCAAGGTC TGG (reversed) Intronic