ID: 944752009

View in Genome Browser
Species Human (GRCh38)
Location 2:202718576-202718598
Sequence TTAAAAATTTTGTTGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 949
Summary {0: 1, 1: 0, 2: 9, 3: 102, 4: 837}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944752007_944752009 2 Left 944752007 2:202718551-202718573 CCACTTCGTTGTGGTATATGATT 0: 1
1: 0
2: 18
3: 92
4: 339
Right 944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG 0: 1
1: 0
2: 9
3: 102
4: 837
944752005_944752009 16 Left 944752005 2:202718537-202718559 CCTAGGGATAAATGCCACTTCGT 0: 1
1: 3
2: 205
3: 605
4: 1347
Right 944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG 0: 1
1: 0
2: 9
3: 102
4: 837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944752009 Original CRISPR TTAAAAATTTTGTTGTTGGT TGG Intronic
900074077 1:798118-798140 CTACAAATTATCTTGTTGGTAGG + Intergenic
901102934 1:6733377-6733399 TTAAAAATTTTGGTTTTGGCCGG + Intergenic
901576186 1:10202909-10202931 TTAAAAATTTTAATCTTTGTTGG + Intergenic
901960983 1:12826463-12826485 TTAAAAATTATCTTGTTGGCTGG + Intronic
901967580 1:12881067-12881089 TTAAAAATTATCTTGTTGGCTGG + Intronic
901975378 1:12940198-12940220 TTAAAAATTATCTTGTTGGCTGG + Intronic
901982983 1:13051329-13051351 TTAAAAATTATCTTGTTGGCTGG + Intronic
901986039 1:13076007-13076029 TTAAAAATTATCTTGTTGGCTGG - Intronic
901995770 1:13150760-13150782 TTAAAAATTATCTTGTTGGCTGG + Intergenic
901999107 1:13177589-13177611 TTAAAAATTATCTTGTTGGCTGG - Intergenic
902009797 1:13261567-13261589 TTAAAAATTATCTTGTTGGCTGG - Intronic
902017593 1:13320718-13320740 TTAAAAATTATCTTGTTGGCTGG - Intronic
903089213 1:20895074-20895096 TAAAAAATTTTGTGTTTGTTGGG - Intronic
903601280 1:24542628-24542650 TTAAAAATTTTGTTTTTGGCCGG - Intergenic
903729412 1:25480628-25480650 TTAAAAAATATATTGTTGGCTGG + Intronic
903821721 1:26108178-26108200 TTAAAAAAGTTTTTGTTGGCTGG - Intergenic
904178518 1:28648979-28649001 TTTTAAATTCTTTTGTTGGTGGG - Intergenic
905131060 1:35758131-35758153 TTAAACATCTTATTGTTGGCAGG - Intronic
905431639 1:37928786-37928808 TTAAAAATGCTGTTTTTGGCTGG - Intronic
906349936 1:45049994-45050016 TGAAAATTTTTGTTTTTGTTTGG - Intronic
906359409 1:45139832-45139854 TTAAAATTTTTGCTGTTGCTGGG - Intronic
906414474 1:45609902-45609924 TTAGAAATTTTGTCGTGGGCTGG + Intronic
906435749 1:45795144-45795166 TTAAAAATTTTTTTTTTGGCTGG + Intronic
906769031 1:48467017-48467039 TTAAAACTTTTGTCTTTGATGGG - Intronic
907515818 1:54992708-54992730 TTAAAAAATTTGTTGTAGAGAGG + Intergenic
907620994 1:55980086-55980108 TTAAAAATGTTGTGGTGTGTGGG - Intergenic
907766777 1:57420974-57420996 TCAAACATTTTGTTTTTGCTGGG - Intronic
907890750 1:58634454-58634476 TCAAAATTTTTATTGTTGCTGGG - Intergenic
908376010 1:63541856-63541878 TTAAAAATTGTGTTGGGGCTGGG - Intronic
908718528 1:67097251-67097273 TTATACATTTATTTGTTGGTTGG - Intronic
909027364 1:70498077-70498099 TTAAAAATTGAGTTGTTAGATGG - Intergenic
909070186 1:70984546-70984568 TTAAAACTTTCTTTTTTGGTAGG - Intronic
909254452 1:73401596-73401618 GTTAAGATTTTGTTGTTGGCCGG - Intergenic
909313953 1:74191251-74191273 TGAAGTAATTTGTTGTTGGTAGG + Intronic
909958950 1:81813204-81813226 TTTAGAATTTGCTTGTTGGTTGG + Intronic
910308926 1:85800991-85801013 TTATTAATTTTGTTTTTTGTGGG - Intronic
910348383 1:86267388-86267410 CTAAAAAGTTTGTTTTTGTTTGG - Intergenic
910383013 1:86650136-86650158 TTACAAAATTTTTTCTTGGTAGG + Intergenic
910446795 1:87306598-87306620 TTAAAAATTTTGTTAGTGACAGG - Intergenic
910778203 1:90897598-90897620 TTTAAAATTATGTCATTGGTAGG + Intergenic
910879203 1:91907337-91907359 TAAAAATTTTTATTGTTTGTGGG - Intergenic
911024330 1:93421095-93421117 ATAAACATTTTGTGGTTGGGAGG + Intergenic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
911853544 1:102849555-102849577 TTTAAAATTTTAATTTTGGTGGG - Intergenic
911925345 1:103823078-103823100 TTTAAAATTTTATTTTTTGTGGG - Intergenic
912785363 1:112598092-112598114 TTAAATATTTTGTTGTGTTTTGG - Intronic
912991550 1:114492466-114492488 TTGAAAATTATGGTGATGGTTGG - Intronic
915812241 1:158925713-158925735 TTAAAAAGTTTTTTATTGTTTGG + Intergenic
915959407 1:160252555-160252577 ATAAAAGCTTTGTTGTTGGGGGG + Intronic
916154014 1:161826307-161826329 TTAAAAATTTTTTGTCTGGTGGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916468011 1:165091841-165091863 TTCAAAATTTTGTTTTTAATGGG - Intergenic
916748024 1:167699316-167699338 TTCAAAATTAAGTTGTTGGCTGG + Intronic
916895622 1:169159075-169159097 TTATGATTTTTGTTGTTGCTGGG - Intronic
917061023 1:171039609-171039631 TTAAAAATCTAGTTGTTAGCTGG + Intronic
917269546 1:173258229-173258251 TTACCATTTTTGTTCTTGGTGGG - Intergenic
917359890 1:174163626-174163648 TAAAGAATTGTGTTGTTGTTGGG - Intronic
917461401 1:175233625-175233647 TTAAACTTTATGTGGTTGGTTGG + Intergenic
917774802 1:178321690-178321712 TTAAAAAAATTTTTGTAGGTCGG + Intronic
917779974 1:178384065-178384087 TTAATAATTTTGATATTTGTAGG - Intronic
918027657 1:180768138-180768160 TTAAAAAGTTTCTTGTGGGCCGG - Intronic
918167448 1:181963922-181963944 TTCAAATTGTTGTTGCTGGTGGG + Intergenic
918271098 1:182900725-182900747 TTTAATATTTTGTTATTGGCTGG - Intronic
918274711 1:182942518-182942540 TTAAGAATTTTACTCTTGGTGGG - Intronic
918953010 1:191164590-191164612 TAAGAAATTTTGTTTCTGGTTGG - Intergenic
919272411 1:195364935-195364957 TTAAAATTTTTAATGTTTGTGGG - Intergenic
919516835 1:198535429-198535451 TTAAAAAAATTATTGATGGTTGG + Intronic
919580178 1:199362398-199362420 TGAAAAATGTGGTTGATGGTTGG + Intergenic
919587888 1:199462425-199462447 GCAAAAGTTTTGTTGTTGTTTGG - Intergenic
919694465 1:200560249-200560271 TTAAAAGTTTTTTGGTTGTTTGG + Intronic
919710007 1:200716941-200716963 TTTTAAAGTTTGTTGTTTGTAGG - Intergenic
921874175 1:220175578-220175600 TTTGAAACTTTGTTGTTGATGGG - Intronic
922269928 1:224023025-224023047 CTACAAATTATCTTGTTGGTAGG + Intergenic
922491719 1:226022667-226022689 TTAAAACTTTTTTTGTTGGCCGG + Intergenic
923016577 1:230130990-230131012 TTTAAAATTTTTATGTTGGAGGG - Intronic
923238365 1:232056992-232057014 TTGTTAATTTTGATGTTGGTGGG + Intergenic
923626718 1:235620065-235620087 TTAAAACTTTCGTTGGAGGTTGG + Intronic
923968425 1:239170898-239170920 TTTTAACTTTTGTTTTTGGTTGG - Intergenic
924492540 1:244553263-244553285 TTAAAAATATTGTTGCTGGCCGG + Intronic
924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG + Intronic
1063396651 10:5693943-5693965 TTATAAATTTACTTTTTGGTGGG - Intronic
1063598933 10:7462652-7462674 TTAAAAATGTTATTCTAGGTCGG - Intergenic
1063904633 10:10768989-10769011 TTTACAATTTTGTTTTTAGTAGG - Intergenic
1064234346 10:13560238-13560260 TTATTTATTTTGTTTTTGGTTGG + Intergenic
1064715296 10:18170611-18170633 TTAAAAATTAGAATGTTGGTGGG + Intronic
1064912930 10:20422988-20423010 TGAAAAATTTTATTGGTAGTGGG + Intergenic
1065018699 10:21484677-21484699 ATAAAAAATTTGTTGTAGGCTGG - Intergenic
1065382328 10:25102773-25102795 TTAAAAAAATTGTTCTGGGTGGG + Intergenic
1065611671 10:27477299-27477321 TAAAAAATTTTTGTGATGGTTGG - Intergenic
1065807938 10:29412035-29412057 TTAAAATTTTTTTTGTAGATGGG + Intergenic
1065859162 10:29856694-29856716 TTAAAACATATGTTGTTGGCTGG + Intergenic
1065925584 10:30432238-30432260 TTTTAAATTTTATTTTTGGTTGG + Intergenic
1068984283 10:63092683-63092705 TTTAAAAATTTTTTGTTGGCGGG - Intergenic
1069268457 10:66493546-66493568 TTAATTTTTTTGTTGTTGTTGGG + Intronic
1069352113 10:67540330-67540352 TTATCAATTATGTTGTTGGATGG - Intronic
1069538750 10:69277269-69277291 TTTAAAATTTTCTTTTTGGCTGG + Intronic
1069666125 10:70161014-70161036 TTACAACTTTTGATCTTGGTGGG - Exonic
1070862099 10:79679116-79679138 TTAAAAATTCAGTTGTAGGGTGG + Intergenic
1070875038 10:79795337-79795359 TTAAAAATTCAGTTGTAGGGTGG - Intergenic
1071330748 10:84557169-84557191 TTAAAAAATTTTTTTTTGGCTGG + Intergenic
1071641962 10:87317507-87317529 TTAAAAATTCAGTTGTAGGGTGG - Intergenic
1071887506 10:89966995-89967017 CTGAAAAATTGGTTGTTGGTGGG + Intergenic
1072262351 10:93691471-93691493 TTAATATTTTTATTTTTGGTTGG - Intronic
1072348138 10:94529320-94529342 TTAAAAATTAAGTTATTGGCTGG + Intronic
1072545491 10:96433648-96433670 TTTAAAATTTTGTTTTCAGTTGG + Intronic
1073369792 10:102977522-102977544 TTAAAAATTGTGTTATTGGCTGG + Intronic
1074385527 10:113013977-113013999 TTAAAAATTTTTATGTTGGGGGG + Intronic
1074474393 10:113756207-113756229 TTTAAAATGTTGTTGGTGGGAGG + Intronic
1075324853 10:121523249-121523271 TTAAGACTTCTGGTGTTGGTGGG + Intronic
1075358848 10:121810994-121811016 TTAAAAAATTTGTTTTGGCTGGG - Intronic
1076303505 10:129446673-129446695 AAAAAAATCTTGTTGTTTGTTGG + Intergenic
1076403630 10:130198271-130198293 TTAAGAATTTTGTTGCAGGTTGG + Intergenic
1076929943 10:133525515-133525537 ATATAAAATTTGATGTTGGTTGG + Intronic
1077370977 11:2181529-2181551 TTAAAAATTTTTTTGTAGAGAGG + Intergenic
1077513166 11:2982720-2982742 TTAAAGATTCTGTTGCTGCTAGG + Intronic
1077871185 11:6262844-6262866 TTAAAATGTTTGTTGGTGATTGG + Intronic
1078227300 11:9404168-9404190 TTAAAAATTTTGTTGGGGCTGGG + Intronic
1078585244 11:12580103-12580125 TTAAAAATTTTTTTTGTGGCCGG - Intergenic
1079014712 11:16858786-16858808 TTAAAAATCTTTTTTTAGGTTGG - Intronic
1079067720 11:17312009-17312031 TTAAAATTTTTCTTTTTAGTTGG + Exonic
1079375848 11:19891101-19891123 TTTAAACTTTTCTTGTTGGCTGG - Intronic
1079435648 11:20445973-20445995 TTTTAAATTTTACTGTTGGTGGG + Intronic
1079629529 11:22657157-22657179 TAAAAGATTCTGTTGATGGTGGG + Intronic
1080251974 11:30243843-30243865 TTGAAACTTTTGTTATTAGTAGG - Intergenic
1080266721 11:30408882-30408904 TTGAATATTTTGTTGTTGTAAGG + Intronic
1081176823 11:39937571-39937593 TTGTAAATTTTGTTGGTGGATGG - Intergenic
1081296793 11:41400427-41400449 CTAAAAATTGTGTTATTGGTTGG - Intronic
1081347212 11:42004170-42004192 TTAAAAAGTTTGTTCTTTGGAGG - Intergenic
1081832238 11:46122854-46122876 TTAAAAAATTTATTGTGGTTGGG - Intergenic
1082030116 11:47597735-47597757 TTAAAATTATTGTTGTTGGCTGG - Intergenic
1082057157 11:47827786-47827808 TTAAAAATTTTTTTGGAGGGAGG - Intronic
1083335755 11:61920625-61920647 CTTAAAACTTTGTTATTGGTGGG + Intergenic
1083384526 11:62297672-62297694 ATAAAAATATTGTTGATGTTAGG + Intronic
1083527324 11:63381364-63381386 TTAGAAATAATGTTGATGGTAGG - Intronic
1085192741 11:74642529-74642551 TGGAAAATTCTGGTGTTGGTTGG + Exonic
1085658495 11:78339881-78339903 TTTAGAATTTTGTGGTTGGAAGG - Intronic
1085674263 11:78500641-78500663 TTAAAAATTTTTTTATAGATGGG + Intronic
1085821213 11:79795603-79795625 TTAAATTTTTTGATGGTGGTAGG - Intergenic
1086115765 11:83247921-83247943 TAAAAAATTTTGTTTTTGATAGG + Exonic
1086243607 11:84724737-84724759 TCAAAAATATTTTTGTTAGTTGG - Intronic
1087041673 11:93807113-93807135 TTAAAACTTTTTTTTTTGGCCGG + Intronic
1087936646 11:104041780-104041802 ATAAAAATTTTCTTGTTTCTAGG + Intronic
1088190513 11:107223209-107223231 TTAAAAATTTTGAAGAGGGTTGG - Intergenic
1088323197 11:108574203-108574225 TTAAAAATCTTTTTGTAGGTTGG - Intronic
1088547792 11:110978559-110978581 TTAAAAATTTTGTTTTTAATGGG - Intergenic
1088560373 11:111109287-111109309 TTAAACACTTTATTATTGGTAGG - Intergenic
1088688847 11:112307424-112307446 ATAAAAATTCTTTTTTTGGTAGG + Intergenic
1088838405 11:113600412-113600434 TTCAATATTTTGTTATTGGTTGG - Intergenic
1088839701 11:113614957-113614979 TCAAAAATTTTGCTGTCAGTAGG + Intergenic
1089290516 11:117435348-117435370 TTAAACATTTCCATGTTGGTTGG - Intronic
1089476823 11:118770591-118770613 GTGAAAATATTGTTGTTGGCTGG + Intronic
1090159508 11:124477987-124478009 TTAAAAATAGTGTTGTTGCTGGG - Intergenic
1090282518 11:125468484-125468506 TTAAAAATTATGTTATGGGCTGG - Intronic
1090452669 11:126820544-126820566 TAAAAAATTTTGTTGAAGGAGGG + Intronic
1090676061 11:128997646-128997668 TCAAGAATTTAGTTGTTGGATGG - Intronic
1091752230 12:3030172-3030194 TAAAAAGTTTTTTTGTTTGTTGG + Intronic
1092249246 12:6883349-6883371 TAAAAAATTTTTTTATTGGCCGG - Intronic
1092504254 12:9079466-9079488 TTAAATATTTTATTGGAGGTTGG + Intronic
1092745687 12:11670089-11670111 TTTAAAATTTTCTTGTTCTTCGG + Intronic
1093239002 12:16645754-16645776 TTATAAATTTTTTTGTTGATTGG + Intergenic
1093468198 12:19472167-19472189 TTAAAAATTTTATTTTAGGCTGG + Intronic
1093915823 12:24801595-24801617 TTAAAACTTTTTTTTTTAGTAGG - Intergenic
1094388017 12:29916394-29916416 TGAAGAATTTTGCTATTGGTAGG + Intergenic
1094773045 12:33688294-33688316 TTAAAAATATTTCTCTTGGTTGG - Intergenic
1095877068 12:47090831-47090853 TTAACTATTTTGTTGTTCATGGG + Intronic
1095889348 12:47221473-47221495 TTAAAAATTTTCATGTTGGCGGG - Intronic
1095928236 12:47600780-47600802 TTAAACATTTTGGTGTTGGAAGG + Intergenic
1096213175 12:49782100-49782122 TGAATAATTATGTTGTAGGTAGG - Intergenic
1096744707 12:53718458-53718480 TTAAAAACTTTATTGGTGGGAGG + Intronic
1097257419 12:57689941-57689963 TTAAAAATTTTATTTTTGTGTGG + Intergenic
1097373273 12:58809993-58810015 TTAAAGATTCTTTTGATGGTGGG - Intronic
1097731649 12:63135097-63135119 TAAAAAATTTAGTTATTGGCTGG + Intergenic
1097870073 12:64594410-64594432 TTAAAAACTTTATTGGTGGGAGG - Intergenic
1097911737 12:64977767-64977789 TAAAAAATTTTTTTATTTGTTGG + Intergenic
1098699119 12:73600455-73600477 TTAAAAATGGTGGTGGTGGTGGG - Intergenic
1098817473 12:75185747-75185769 TTATAAATTTTATTGTAGGCTGG + Intronic
1099154274 12:79155355-79155377 TTAAAAATTCAGATGTTGGAAGG + Intronic
1099283551 12:80684983-80685005 TTAAAAATATTATTTTTGCTTGG - Intergenic
1099451222 12:82809580-82809602 TTAAAAATCTTATTGCTGTTAGG + Intronic
1099518509 12:83629336-83629358 TTTAAAATTTTGTTTTGGGTTGG + Intergenic
1100114883 12:91292429-91292451 ATAAATATTTTTTTGTTTGTGGG + Intergenic
1100845104 12:98650194-98650216 TTAATAATTTTTTTTTTAGTAGG + Intronic
1101300260 12:103472347-103472369 TTAAAAATTGAGTTGTGGCTGGG - Intronic
1102121155 12:110442161-110442183 TTAAAAATTTTTTTTTTGCCTGG - Intronic
1102134305 12:110560022-110560044 TTAAGAATTTTCTTCTTGGCTGG - Intronic
1102641454 12:114370789-114370811 TTAAAAATTTTTTTGTTTTGGGG + Intronic
1103116700 12:118340271-118340293 TTAAAAATTTTTTTGCTCTTGGG - Intronic
1104021028 12:124992492-124992514 TTAAAAACTTTTTTGTAGGTCGG - Intergenic
1104432873 12:128730963-128730985 TGAAAAATTTTGGTATTGATAGG - Intergenic
1104525665 12:129518906-129518928 TTAAAAATTTTAATGAAGGTTGG + Intronic
1104551742 12:129763372-129763394 TTAAAAGTTGAGTTCTTGGTCGG - Intronic
1105287828 13:19021371-19021393 TTAAAAATTGTGGTGGTGGGGGG + Intergenic
1105436643 13:20384716-20384738 TTAAAAATTTTTTTGAGGGGTGG + Intergenic
1105456514 13:20546011-20546033 TTAAAAATTTTATTTTAGGCCGG + Intergenic
1105554084 13:21428909-21428931 TAATAATTTTTGTTGTTGTTGGG - Intronic
1106099310 13:26680874-26680896 ATAATAATTATGTTGTTGCTTGG + Intronic
1106114709 13:26807297-26807319 TTAAAAATTTTCTGATTGATTGG - Intergenic
1106448609 13:29859535-29859557 TGAAAAATTTTTTTGTTGGCTGG - Intergenic
1106449677 13:29869001-29869023 TTAAAAATTTGTTTATTGGTTGG + Intergenic
1106687906 13:32081175-32081197 TTAAAAATTTTTTTCTTGTTTGG - Intronic
1106835139 13:33625954-33625976 TTAAGAATTCTCTTGTTGGGAGG - Intergenic
1107232920 13:38132437-38132459 AAAAAAATTCTGTTGTTGTTGGG + Intergenic
1107765429 13:43729482-43729504 TTAAAAACTCAGTTCTTGGTGGG - Intronic
1107860532 13:44656205-44656227 TGAAATATTTTGTTACTGGTTGG - Intergenic
1107994224 13:45844896-45844918 TTGAAAGTTTGGTTGTTGCTGGG - Intronic
1108310255 13:49182283-49182305 TTTAAAATTTTATTTTTGGCCGG - Intronic
1108525598 13:51283451-51283473 TTAGAATTTTTGTTGTTGACTGG - Intronic
1109212841 13:59554661-59554683 TTTAAAATTTAATTATTGGTGGG - Intergenic
1109815780 13:67582523-67582545 TTAAAAATCTTTTTTTTGGTGGG + Intergenic
1109900055 13:68756664-68756686 TTCAAAATTTAGTTCTTGATGGG + Intergenic
1109959492 13:69612478-69612500 TTAAAAATGTTGCTGGTGGAAGG + Intergenic
1109997807 13:70152919-70152941 TTATAAATGTGGTTATTGGTTGG - Intergenic
1110123088 13:71907569-71907591 TTAAAACTTCTGATGTTGGCCGG + Intergenic
1110681219 13:78314428-78314450 TTTAAAGTATTATTGTTGGTTGG - Intergenic
1110927749 13:81176848-81176870 TTAAAATTTTTGCTGTTGGCTGG - Intergenic
1111206277 13:85015259-85015281 ATCAAAATTTTATTGTTGGACGG + Intergenic
1111289828 13:86150839-86150861 TCCAAAATTTTGTTATTTGTTGG - Intergenic
1111526685 13:89480408-89480430 TAAAAAATTTATTTGTTGGCCGG - Intergenic
1111696853 13:91635481-91635503 TTAAACATCTTCCTGTTGGTGGG + Intronic
1111710887 13:91813221-91813243 TTATAAATTTATTTGTTGCTAGG + Intronic
1112114053 13:96333720-96333742 TTAAATATTTTTTTGATGGCAGG + Intronic
1112288320 13:98123521-98123543 TTAAAAATTTGGATCTTGTTAGG - Intergenic
1112296305 13:98190134-98190156 TGAAAAATTTTAATGGTGGTGGG + Intronic
1113133463 13:107063052-107063074 TTAAAAATCTTGAGGTTGGCTGG - Intergenic
1113273689 13:108704366-108704388 TTAAGAATTTCGTTTTTGCTGGG + Intronic
1114456658 14:22859258-22859280 TTAAAAATTTTTTTGTAGGATGG - Intergenic
1114725751 14:24934820-24934842 CTAAGAATTTTGTTGTTAGGAGG + Intronic
1115227999 14:31125100-31125122 TAAAAAAATTTATTGTTGGCCGG - Intronic
1115301073 14:31886055-31886077 ATAAAAATTTTGTTTTAGGAAGG - Intergenic
1115435435 14:33366930-33366952 TTAAAAATTTTCCTTTTGGATGG - Intronic
1115643364 14:35349808-35349830 AAAATAATTTTCTTGTTGGTAGG - Intergenic
1115692263 14:35856943-35856965 TTAAAAAATTTGTTGTGGCCGGG + Intronic
1115991962 14:39159445-39159467 TTGAAAATTTTCTTGCAGGTAGG - Intronic
1116025803 14:39512892-39512914 TTAAAATTTTTATTATTTGTTGG + Intergenic
1116513576 14:45778711-45778733 ATATATATTTTGCTGTTGGTAGG + Intergenic
1116555798 14:46305548-46305570 TTAAATATTTTGGGGTTCGTGGG + Intergenic
1116741036 14:48755043-48755065 TTTCTAATTTTGTTGCTGGTTGG + Intergenic
1116791098 14:49341153-49341175 TTTAAAATTTTTTTGTTGAAAGG - Intergenic
1116828600 14:49695766-49695788 TTAAAAAATCTATTGTTGGCCGG + Intronic
1116991650 14:51283708-51283730 CTAACATTTTTGTTGCTGGTAGG - Intergenic
1117036900 14:51739460-51739482 TTAAAAATTTGCTTTTTGCTAGG + Intergenic
1117132689 14:52701931-52701953 TTAAAAAATTTTTTTTTGGCCGG - Intergenic
1117217200 14:53563469-53563491 TTAAAAATTTTGTTCTTCAAAGG + Intergenic
1117509228 14:56431969-56431991 TCAATAATTTTTTTTTTGGTAGG + Intergenic
1117740813 14:58817267-58817289 TAAAAAAGTTTGTTTTCGGTGGG + Intergenic
1117932598 14:60859294-60859316 TTAAAAATTCAGTGGTTGGTAGG + Intronic
1118180711 14:63489702-63489724 TTAAGAATTTTGGTATTGGCTGG - Intronic
1118654881 14:67936054-67936076 TTAAAATTTTTGTTTTTTGAAGG - Intronic
1118665496 14:68064961-68064983 TTATAAATTTTCATTTTGGTGGG + Intronic
1118722000 14:68601010-68601032 TTGGAAATTTTGTTATTGTTTGG + Intronic
1119030712 14:71190066-71190088 TGAAAAATTTTGGAGATGGTTGG + Intergenic
1119336856 14:73840622-73840644 TTAAAAAAATTTTTGTTGGCCGG + Intergenic
1119338961 14:73858794-73858816 TTAAAAATTTTTTTATTTATAGG + Exonic
1120336796 14:83167688-83167710 ATAAAAACTGTGTTGTTGGCTGG + Intergenic
1120404376 14:84076220-84076242 TTAAATATTTTCTGGATGGTGGG - Intergenic
1120544691 14:85796424-85796446 TGAAACACTTTGTTGTTGTTTGG - Intergenic
1120954544 14:90070014-90070036 TTACAGTGTTTGTTGTTGGTTGG - Intronic
1121097478 14:91227899-91227921 ATAAATATTTTGGTGGTGGTAGG - Intergenic
1121632963 14:95434178-95434200 TTAAATATTTTGTCCTTAGTGGG - Intronic
1121808907 14:96861135-96861157 TTGAAAATTTCCTTGTTTGTTGG + Intronic
1122440170 14:101726389-101726411 TTAAAAATGTTTTTGTGAGTCGG - Intergenic
1123001241 14:105295611-105295633 TAAAAAAATTTTTTTTTGGTTGG - Intronic
1124028152 15:25986002-25986024 TTAAAAATTCTGTTCTGGGCTGG - Intergenic
1124259881 15:28179074-28179096 TTAAAAACTTTTTTGTTTTTTGG + Intronic
1124321741 15:28718158-28718180 TTAAAAATTTTGTTGTATCATGG - Intronic
1124522839 15:30419996-30420018 TTAAAAATTTTGTTGTATCATGG - Intergenic
1124535826 15:30546221-30546243 TTAAAAATTTTGTTGTATCATGG + Intergenic
1124762824 15:32461379-32461401 TTAAAAATTTTGTTGTATCATGG - Intergenic
1124775802 15:32587679-32587701 TTAAAAATTTTGTTGTATCATGG + Intergenic
1124784502 15:32667290-32667312 TTAAAAATTTGGTTGGAAGTGGG + Intronic
1125062770 15:35444115-35444137 TTAAAAAGGTTGTTTTTGTTGGG - Intronic
1125491758 15:40153777-40153799 TTAAAAATTTTGATCTCGGCCGG + Intergenic
1125547702 15:40519179-40519201 TCAAAAATTATGTTGTGGGCCGG + Intergenic
1125586382 15:40823276-40823298 TTAAAAATTTTTTTGTTGAGTGG + Intronic
1125899744 15:43334329-43334351 TTTAAAATTTTATTTTTGGCCGG + Intronic
1126160122 15:45604066-45604088 TTAAAAATAGTTTTGTTTGTGGG + Intronic
1126692254 15:51296741-51296763 TTAAAAATGGTGTTCTTAGTGGG + Intronic
1126862313 15:52897605-52897627 TTAAAATTTTTATTTTTTGTGGG + Intergenic
1126989113 15:54351059-54351081 TTTAAAATATAGTTGTTGATTGG + Intronic
1127173783 15:56331686-56331708 TTAAAAATTTTTTTTTATGTAGG - Intronic
1127366818 15:58299163-58299185 TTAAGAAATTTGTCTTTGGTGGG + Intronic
1127799385 15:62464681-62464703 CAAAAAATTTTGGTGTTGTTGGG + Intronic
1128174668 15:65544550-65544572 TTAAAAATTTTTATTTTTGTGGG + Intronic
1128523791 15:68394229-68394251 TTAAAATCTTAGTTGTTTGTTGG - Intronic
1128900102 15:71412736-71412758 TTCAAAATGTTGTTGGTGGGGGG - Intronic
1129076633 15:73002476-73002498 GTAAAAATTTTGTTTTAGGCCGG - Intergenic
1129435766 15:75539088-75539110 TTAAAAAATTTTTTTTTGGCCGG + Intronic
1130291082 15:82601543-82601565 AAAAAAATTTTTTTGTTGGGTGG - Intronic
1130515555 15:84623386-84623408 TTAAAAATAATGTTCTTGGCCGG - Exonic
1130517984 15:84640787-84640809 TTAAAAGGTTTGTTGTTCTTGGG + Exonic
1130922193 15:88357047-88357069 TTAAAAATTATGTTTTTGCGGGG + Intergenic
1131136992 15:89944704-89944726 TTAAAAAAATTTTTTTTGGTAGG + Intergenic
1131142433 15:89988331-89988353 TTAAAAATCCACTTGTTGGTTGG + Intergenic
1131184035 15:90260200-90260222 TTAAAAATATTGTTGTGGCCAGG + Intronic
1131238935 15:90721634-90721656 TTAAAAATATTTTTATTGGCCGG + Intronic
1131303401 15:91219583-91219605 TTAAATATTTTTTTGGGGGTGGG + Intronic
1131874586 15:96791187-96791209 TTAAAACTTACGTTTTTGGTTGG + Intergenic
1132171179 15:99657386-99657408 TTTAAAATTTTGATATTGTTGGG + Intronic
1132360309 15:101207352-101207374 TTTAAAATACTGTTGTTAGTTGG - Intronic
1132369399 15:101283648-101283670 TTAAAAAATTTCTTTTTGGCTGG + Intronic
1133243332 16:4429515-4429537 TTAAAAATCTTTTTGTAGGCCGG - Intronic
1133440138 16:5814630-5814652 TTAAAAATTTTATTCCTGGCCGG + Intergenic
1133634544 16:7653201-7653223 TTAAAAATATGTTTGTGGGTTGG + Intronic
1133644485 16:7751319-7751341 TTAAAAACATTGATGTAGGTTGG + Intergenic
1134103979 16:11472103-11472125 AGAAATATTTGGTTGTTGGTAGG - Intronic
1134405108 16:13950255-13950277 TTAAAAATAATTTTGTTGGGTGG - Exonic
1135660385 16:24291570-24291592 AGAAAAATTTTGTTGGTGGAAGG + Intronic
1135661057 16:24296966-24296988 TTAAAAATATTGACGTTAGTTGG + Intronic
1136985004 16:35094444-35094466 TTGAATATTTTGTTTTTGATTGG - Intergenic
1137507645 16:49068318-49068340 TGAAAAATTGGGTTGTTGATTGG + Intergenic
1138160702 16:54750704-54750726 TTCAAAATTTGGTTTTTGGGGGG - Intergenic
1138249004 16:55488300-55488322 TCAATCATTTTGTTGTTGGGTGG + Intronic
1138420578 16:56896446-56896468 TTTAAAATTGTGATGTTGGCTGG + Intronic
1138462755 16:57161805-57161827 TTAAAAATTATGATCTTGGCCGG - Intronic
1138681762 16:58688837-58688859 TTAAAAATTATTTTATTGGCCGG + Intergenic
1138870778 16:60881300-60881322 TTAATAATTTTCTTCTTGATAGG - Intergenic
1139201004 16:64976886-64976908 TTCAAAGCTTTTTTGTTGGTTGG - Intronic
1139637765 16:68268707-68268729 TTAAAAATTTTTTTGTTGGCTGG + Intronic
1139710766 16:68774226-68774248 TTAAAATGTTTGTTGATGGCTGG + Intronic
1139743369 16:69054635-69054657 TCAAAACTTTTGTTGCTGGCCGG + Intronic
1140092288 16:71848540-71848562 TTTAGAATTTTGTTGTTCTTTGG + Intronic
1140340081 16:74149433-74149455 TTAATGATTTTGTTATTGCTTGG + Intergenic
1140416388 16:74776596-74776618 TAAAAAATTATATTGTTGGCTGG + Intergenic
1140977717 16:80076202-80076224 TTAAAAATTTAGATTTTGGCTGG - Intergenic
1141940013 16:87269336-87269358 TTAAAGATTTTTTTGATGGCAGG - Intronic
1142488532 17:262508-262530 GTAAAAATTATTTTGTTGGCCGG - Intronic
1142519625 17:495729-495751 ACAAAAATTTTGTAGTTGGCTGG - Intergenic
1146073722 17:29708290-29708312 TTAAAAAGTCTGTTCTTGCTAGG + Intronic
1146216892 17:30983935-30983957 TTCAAAATTCAGTTGTTTGTGGG + Intronic
1146892188 17:36513430-36513452 TTAAAGATGTTGTTCTGGGTAGG + Exonic
1147315946 17:39620295-39620317 TTAAAAATTTTGTCCCTGATAGG + Intergenic
1147587612 17:41661371-41661393 TTAAACATTTTCTTGTTGTTGGG - Intergenic
1148289619 17:46432958-46432980 TTAAAAAGTTAGTTTTGGGTTGG + Intergenic
1148311787 17:46650530-46650552 TTAAAAAGTTAGTTTTGGGTTGG + Intronic
1148717791 17:49728208-49728230 TTAAAAATGTTTTTCTTTGTGGG - Intronic
1149186087 17:53999729-53999751 TTAAAAATTTTTTTGAGGCTGGG - Intergenic
1149317597 17:55453143-55453165 TTAAAAATTTTGTTGTGTGTTGG - Intergenic
1149713297 17:58762599-58762621 TTAAAAAATTTGTTTTGGGCCGG + Intronic
1149766936 17:59286848-59286870 TTAAAAATTTTTTTGTAGAGAGG - Intergenic
1149820788 17:59775238-59775260 TTAAAAAATTTTTTGTAGGCCGG - Intronic
1149874625 17:60219188-60219210 TTAAGGTTTTTGTTGTTGTTTGG - Intronic
1149927789 17:60718763-60718785 TAAAAAATTTAGTTGTAGGCTGG + Intronic
1150056619 17:62022602-62022624 TTAAAAATTTTCCTGTGGCTGGG - Intronic
1150057905 17:62036268-62036290 TTTAAAATAATGTTATTGGTTGG - Intronic
1150088414 17:62296439-62296461 TTAAGGTTTTTGTTGTTGTTTGG - Intergenic
1150385458 17:64755916-64755938 TAAAACATTTTTTTGTTGTTGGG - Intergenic
1150691143 17:67368003-67368025 TTTAAAATTTGTTTCTTGGTTGG - Intergenic
1150847948 17:68678303-68678325 TTTAAAATGTAGTTGTTGGCTGG - Intergenic
1150992363 17:70274344-70274366 TGAAAGGTTTTGTTGTTGGTAGG + Intergenic
1151060430 17:71085827-71085849 CTAAACTTTTTGTTGTTGCTCGG - Intergenic
1151652638 17:75479612-75479634 TTTAAAATTTTTTTGTAGGCCGG - Intronic
1152515820 17:80823928-80823950 TTAAAAATATTTGTGTTGTTAGG - Intronic
1152679782 17:81661089-81661111 TTAAAAATTGTTTTGTAGGCTGG + Intronic
1152905544 17:82968701-82968723 TTAAAATTTGTCTTGTTGGCCGG + Intronic
1153074955 18:1151504-1151526 TTTAAAATTTTTTTTTAGGTTGG + Intergenic
1153163367 18:2234157-2234179 TTAAAAAATTTGTTTTTGATTGG - Intergenic
1153232517 18:2952803-2952825 TTAACCATTTTCTTGCTGGTAGG - Intronic
1153515479 18:5896671-5896693 ATAAATATTTTGGTGGTGGTGGG + Intergenic
1153708256 18:7769565-7769587 TTAAAAAATTTTTTGGTGGTGGG + Intronic
1154972056 18:21419742-21419764 TTAAAAAGTCAGTTGTGGGTGGG - Intronic
1154984682 18:21537866-21537888 TTCAAACTTTTGTTGTTCGAGGG - Intronic
1155135222 18:22985022-22985044 TTAAAATTGTGGTTATTGGTGGG + Intronic
1155493165 18:26419307-26419329 TTAAAAACTTCTTTGTTGGCAGG + Intergenic
1155543596 18:26890843-26890865 TTTAAAATTTTGTTTTGAGTTGG + Intergenic
1155617101 18:27734769-27734791 TTAAAAATGTCTTTTTTGGTCGG - Intergenic
1155637112 18:27969161-27969183 TTAGCAAATTTTTTGTTGGTGGG - Intronic
1155639022 18:27990917-27990939 TTAAAAATAATACTGTTGGTAGG + Intronic
1156279964 18:35627569-35627591 TTAAAAATTATGTTGATTGGGGG + Intronic
1156376669 18:36521090-36521112 TTAAAACTTTTTTTGTGGGTGGG + Intronic
1157430834 18:47624572-47624594 TTAGAATTTTGGTTGTTTGTAGG - Intergenic
1157853543 18:51082172-51082194 TTAACAATTATTTTGTAGGTGGG + Exonic
1158027383 18:52916958-52916980 TTAAAAATATTATTTTTGATGGG + Intronic
1158129974 18:54141616-54141638 TTTGAAATTTTTTTGTTGTTGGG - Intergenic
1158216172 18:55102895-55102917 TTAAAAAATTGGTTTTTGGCTGG - Intergenic
1158419066 18:57276677-57276699 TTAAAAATCTTATTGTTGGTGGG - Intergenic
1158424304 18:57325245-57325267 TTAAAAATTTTGGTCTTTATCGG - Intergenic
1158774369 18:60558997-60559019 TTAAAACTTTTGATTTTGTTAGG + Intergenic
1159181443 18:64911599-64911621 GGAAGAATTTTGTTGTTGTTTGG - Intergenic
1159261706 18:66021853-66021875 TTTTAATTTTTGTTTTTGGTGGG + Intergenic
1159716224 18:71827049-71827071 TTAAATATTTGCTTGTAGGTTGG - Intergenic
1159861757 18:73657726-73657748 CTATAAATTTAGTTGTTGCTAGG - Intergenic
1160047028 18:75395909-75395931 TTAAAAGGTTTGTTTTGGGTTGG - Intergenic
1160220154 18:76970196-76970218 TTTAAACTTTTGTTCTTGCTGGG + Exonic
1160475570 18:79182785-79182807 TTGAGAATTTGCTTGTTGGTAGG + Intronic
1161270890 19:3388653-3388675 TTAAAAATTTTGTTGGGGGGGGG - Intronic
1161484434 19:4527366-4527388 TTAAAAATTTTTTTTTAGGCCGG - Intronic
1163212462 19:15851294-15851316 TTAAAAATTTTCTGATTGGCAGG - Intergenic
1163279405 19:16306411-16306433 TTAAAAAATTTTTTGTGGCTAGG + Intergenic
1163363656 19:16863996-16864018 TTAAAAATTTTGTTTGGGCTGGG + Intronic
1164077188 19:21830446-21830468 ATAATTATTTTGTTGTTGTTGGG - Intronic
1164087446 19:21916397-21916419 TGAAAAGTTTTATTGTTGGCTGG - Intergenic
1164662875 19:29993666-29993688 TTAAAAATTATTTTTTTAGTAGG + Intronic
1164682551 19:30145319-30145341 TTAATTGTTTTGTTGTTGATGGG + Intergenic
1164815863 19:31203006-31203028 TTAGAAATTTTGTGATTGTTAGG - Intergenic
1165011804 19:32853938-32853960 TTAACAACTTTTTTGTTTGTTGG - Intronic
1165387879 19:35522153-35522175 TTAAAAATTATTTTTTTGGCCGG - Intergenic
1166371749 19:42305572-42305594 TTAAAAATTTTTTTCTCGGTTGG - Intronic
1166515379 19:43442846-43442868 TTAAAAATTTTTTTGTGAGAGGG - Intergenic
1166521779 19:43485843-43485865 TTTAAAATTTTGTTTTTGGCTGG - Intronic
1166845436 19:45724948-45724970 AAAAAAATTTTGTTGTTGATGGG - Intronic
1166908103 19:46128973-46128995 TTGGAAATTTTTTGGTTGGTAGG + Intergenic
1166982979 19:46642588-46642610 TTTAAAGTTTTTTTTTTGGTGGG - Intergenic
1167496398 19:49821468-49821490 TTAAAAATATTTTTGTAGGTCGG + Intronic
1167782667 19:51609907-51609929 TAAGTAATTTTGTTGTTGTTTGG + Intergenic
1167986546 19:53323468-53323490 TTGGAGAGTTTGTTGTTGGTGGG - Intergenic
1168208671 19:54872271-54872293 TTAAAAATACTATTGTTGGCTGG - Intergenic
1168278593 19:55291240-55291262 TTAAAGATTTTTTTTTTGGCTGG + Intronic
925447198 2:3937552-3937574 TTAAAAAAATTGTTTTTGTTTGG + Intergenic
927184228 2:20470637-20470659 TCAAGAACTTTGTTCTTGGTGGG + Intergenic
927285351 2:21351570-21351592 TTTAAAATTTTTTTTGTGGTTGG + Intergenic
927734150 2:25503320-25503342 TTTAAAATTTTTTTTTTGGAGGG - Intronic
927966271 2:27271285-27271307 CTAAAACTTTAGTTGTTTGTGGG + Intronic
928012640 2:27624595-27624617 TTCAAAATGTAGTTGGTGGTAGG - Intergenic
928037839 2:27842221-27842243 TTAAAAAGTTTGTTATTTGCTGG + Intronic
928146929 2:28787161-28787183 TTAAAAATTATCTTCTTGGCTGG + Intronic
928162059 2:28937416-28937438 TTAAAAATTTTTTTTCTCGTGGG + Intronic
928614348 2:33021514-33021536 TTAAAAATTCTGTTTTTGAGGGG + Intronic
928882333 2:36111647-36111669 TTTAAAATTATTTTGTTGTTGGG - Intergenic
928930393 2:36618041-36618063 TTAAAAATTTACTTGTGGCTGGG - Intronic
929498933 2:42473190-42473212 TTAAAAATATTGTTGAGGGCCGG - Intronic
930255957 2:49091591-49091613 TTAAAAAAATTGTTATTGGCTGG - Intronic
930989744 2:57638616-57638638 TTGAAAATTTTCTTGTTAGTTGG + Intergenic
931034468 2:58222661-58222683 TAAAAAATTTTAGTTTTGGTTGG - Intronic
931261541 2:60623995-60624017 ATAAAATTTTTACTGTTGGTTGG - Intergenic
931358526 2:61558160-61558182 TTATTATTTTTGTTGTTGTTTGG + Intergenic
931518060 2:63063577-63063599 TTAAAAAATTTGTTATTGGTGGG + Intergenic
931742121 2:65256573-65256595 ATAAAAAATTTGTTGTTGGCCGG + Intronic
932136636 2:69236743-69236765 TTAAGAATTTCTTTGTTGTTGGG - Intronic
933003260 2:76954366-76954388 TCCAAAATTTTGTTTTTTGTTGG - Intronic
933077276 2:77944774-77944796 TCAAAAATTATGACGTTGGTAGG + Intergenic
933109384 2:78378493-78378515 ATAAGAATTTTGTTGGTGGTGGG + Intergenic
933336995 2:80971338-80971360 TCAAATATTTTTTTATTGGTAGG - Intergenic
933349154 2:81130895-81130917 TTAAAAATTTTATTGCTATTTGG - Intergenic
933504237 2:83157177-83157199 TTGAAAATTTTATTTTTGATAGG - Intergenic
933571273 2:84015705-84015727 TTAAAAAATTTCATTTTGGTTGG - Intergenic
933581826 2:84135800-84135822 TTAAAGAATTTGGTGTTAGTTGG - Intergenic
933988864 2:87618317-87618339 TTAAAAAAGTTGTTATTGATAGG - Intergenic
935532071 2:104246008-104246030 TTTTAAATTTTATTTTTGGTGGG - Intergenic
935971187 2:108532652-108532674 TTACAAATATTTTTCTTGGTTGG + Intergenic
936043050 2:109164353-109164375 TTAAAAATTTTGTTAGAGATGGG + Intronic
936304980 2:111332510-111332532 TTAAAAAAGTTGTTATTGATAGG + Intergenic
936963096 2:118097534-118097556 TTAGATATTTTTTTGGTGGTGGG + Intronic
937567870 2:123317934-123317956 TGAAACATCTTGTTGTTGTTGGG + Intergenic
938306227 2:130257086-130257108 TTAAAATTCTTGTTGTTTTTAGG - Intergenic
938706734 2:133937531-133937553 TGAAAAGTGTTGGTGTTGGTGGG + Intergenic
939232539 2:139448473-139448495 CTAAGATTTTTGTTGGTGGTAGG + Intergenic
939297042 2:140280331-140280353 TAAAAGATTTTGTTGTTGTGGGG + Intronic
940010670 2:149051459-149051481 TTAAAAATAATGTTGTTGGCCGG - Intronic
940753565 2:157656094-157656116 TTAATAATTTTGTTGAGGGCTGG - Intergenic
940778880 2:157912286-157912308 TTAAAAATTTTGTTCTTGGCTGG + Intronic
941381391 2:164796967-164796989 TTAAAAATTTTTTTAGAGGTAGG - Intronic
941577560 2:167252611-167252633 TTAAAAATTTTGATTTTATTTGG + Intronic
942067933 2:172289305-172289327 TTAAAAATCATGGTGTTGGCCGG - Intergenic
942188772 2:173449919-173449941 TTAAAAATTATATTGTAGGCCGG - Intergenic
942436151 2:175979260-175979282 TTAAAAATGTTTGTTTTGGTCGG + Intronic
942678956 2:178456792-178456814 TTACACATTTTTTTTTTGGTTGG - Intronic
942687581 2:178549610-178549632 TTAACAAGTTTGGTGTTGGCAGG - Exonic
942916674 2:181317206-181317228 TTAAAAATTTAGTCTTTGCTTGG + Intergenic
943167930 2:184355448-184355470 TTATAAATTTTGTAGTTTATGGG - Intergenic
943624780 2:190186246-190186268 CTAAAAATTGTGATTTTGGTTGG - Intronic
944017068 2:195053977-195053999 TTCAAAATTTTGCTTTTTGTTGG - Intergenic
944565203 2:200983052-200983074 ATAAGAATTCTGTTGTTGGCCGG - Intronic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
945294973 2:208161347-208161369 TTAAAAATTTTTTTGTAGAGAGG + Intronic
945541854 2:211097707-211097729 TAAAATCTTTTGTTGTTGGTTGG - Intergenic
946833878 2:223752680-223752702 TTAAAACTTTTATTTTTTGTGGG - Intronic
946951483 2:224880045-224880067 TTCAAAATTTTGTTAGTGTTCGG - Intronic
947078464 2:226369235-226369257 TAAAAAGTTTTCTTTTTGGTTGG - Intergenic
947300214 2:228680833-228680855 TTAAAAAATTTGGTGATGGAAGG - Intergenic
947349602 2:229229388-229229410 TTAAACATTTTATTTTTGGGGGG - Intronic
947364037 2:229375664-229375686 TTTAATATTTTGATTTTGGTTGG - Intronic
947405485 2:229771822-229771844 TTTTACATTTTGTTATTGGTAGG - Intronic
947587759 2:231367144-231367166 TTAAAATTTGTTTTGTTGGCCGG - Intronic
947695749 2:232186958-232186980 TTAAAAATTTTGTGCTTTGAAGG + Intronic
948932489 2:241141112-241141134 TTACAAATTTTATTTTTAGTAGG - Intronic
1168871008 20:1128479-1128501 TTAATAGGTTTGTTCTTGGTAGG - Intronic
1169160154 20:3370724-3370746 TTTAAAATTTTTTTGTTGCCAGG + Intronic
1169589430 20:7123949-7123971 TTAAAAATTCTGTTGCAAGTTGG - Intergenic
1169839269 20:9916472-9916494 TTAGAAATTTTGTTGCAGGGGGG + Intergenic
1170195765 20:13687832-13687854 TTAAAAATTTTGTGGTAGTCAGG - Intergenic
1170219636 20:13928550-13928572 TTTAGAATTTTGTTGTTGATTGG - Intronic
1170502038 20:16983970-16983992 TGACAAATTTTCTTTTTGGTGGG - Intergenic
1171100081 20:22374709-22374731 TTCACAAATTTGTTGTTGTTGGG - Intergenic
1171162231 20:22938160-22938182 TTAAGATTTTTGTTGTTGTTGGG + Intergenic
1171401627 20:24876314-24876336 TTTAAAAATGTGCTGTTGGTGGG - Intergenic
1171863251 20:30420657-30420679 GTAAGTATTTTATTGTTGGTGGG - Intergenic
1171966035 20:31531333-31531355 TAAAAAATTATGTTTTTGGCTGG - Intronic
1172403670 20:34671622-34671644 TTAAAAATTTATTTCTTGGCCGG + Intronic
1172459168 20:35102613-35102635 TTAAAAATGTTTGTGTGGGTTGG - Intergenic
1172858696 20:38029903-38029925 TAAAAAACTTTCTTGCTGGTGGG - Intronic
1173150213 20:40560921-40560943 TTAAAAATTTTTCTATTGATTGG + Intergenic
1173229268 20:41181428-41181450 TTTAAAATTTTCTTCTTGGCTGG + Exonic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1173445536 20:43114599-43114621 TAAAAAATATTGTTATTAGTAGG - Intronic
1173446551 20:43123996-43124018 TTAAAAATTCCTTTGTTTGTCGG - Intronic
1173637488 20:44573370-44573392 TTTAACATTTTGTTGTTGAGAGG + Intronic
1173738126 20:45376079-45376101 TTAAAAATTTTTTTTTTGTATGG - Intronic
1173960288 20:47066041-47066063 TTAAAAATTGTTTTGCTGGCTGG + Intronic
1174394553 20:50238833-50238855 ACAAAAATTATGTTTTTGGTAGG + Intergenic
1174468863 20:50740328-50740350 TTAAAAAGTTAGTTGCTGTTTGG + Intronic
1174614577 20:51825891-51825913 TTAAAAATTTTTTTGTAGGCTGG - Intergenic
1174951225 20:55043026-55043048 TTAAACATTTTTTTGATTGTGGG - Intergenic
1176972205 21:15279838-15279860 TTAGAATTGTTGTTGTTGTTAGG - Intergenic
1177493369 21:21857083-21857105 TTAAAAATTGTTTTATTTGTAGG - Intergenic
1177502596 21:21977530-21977552 TTAAAATTTTTATTTTTGGCAGG - Intergenic
1177657604 21:24039385-24039407 TAAATAATTTTTTTCTTGGTTGG - Intergenic
1177754748 21:25332843-25332865 TTTATAAATTTGTTTTTGGTTGG - Intergenic
1177885380 21:26740325-26740347 GTAAGAATTGTGTTGTTGGTAGG - Intergenic
1178077830 21:29028729-29028751 TTAAAAATGTTGTTGAAGGTCGG - Intronic
1178130375 21:29565257-29565279 TTAAAAAGTTTGCTGTTGTGGGG + Intronic
1178423945 21:32464017-32464039 GGCAAAATTTTGTTGTTGGTGGG + Intronic
1178693475 21:34770648-34770670 TTAAATGTTTTGTTGTTTTTAGG - Intergenic
1178751371 21:35307115-35307137 TTAAAAATGTTAGTGTTGGCCGG + Intronic
1179369782 21:40793933-40793955 TTATTAGTTTTGTTGTTTGTGGG + Intronic
1180744891 22:18080628-18080650 TTAAAAACTTTGTTATTTTTTGG - Intronic
1180926387 22:19558079-19558101 TCAAAATTTTTGTTGTGGGGGGG - Intergenic
1182244015 22:28940846-28940868 TTATAAATTTTTTTCTGGGTGGG - Intronic
1182335229 22:29579722-29579744 TTAAAGATGCTGTGGTTGGTCGG - Intronic
1182337635 22:29595190-29595212 TTAAAAAATACTTTGTTGGTGGG + Intergenic
1182877783 22:33707347-33707369 TTATAAATTTTGTTATAGGGAGG - Intronic
1182944663 22:34310654-34310676 TTAAAATACTTCTTGTTGGTCGG - Intergenic
1183139801 22:35926510-35926532 TTAAATATTTTGTTAATGGATGG - Intronic
1183143029 22:35962022-35962044 TTAAAAATTCTCCTGTTGGGAGG - Intronic
1183158688 22:36095522-36095544 TTAAAAAATATGTTGTTAGCTGG + Intergenic
1183455360 22:37919689-37919711 TTAAAAAATTTTTTTTTGGCCGG + Intronic
1183532719 22:38371166-38371188 TTAATAATTTGGGGGTTGGTTGG + Intronic
1183625976 22:39002137-39002159 TTAAAAATCATCTTGATGGTCGG + Intergenic
1183826836 22:40395167-40395189 AAAAAATTTTTTTTGTTGGTTGG + Intronic
1184621307 22:45680623-45680645 TTAAAAATTTTTTTTTTTTTTGG + Intronic
1185261024 22:49863330-49863352 TTAAAAATTTTTTTGTAGGCCGG + Intronic
949387112 3:3515254-3515276 TTAAAAGTCTTGTTGTTCGTGGG + Intergenic
949998007 3:9634047-9634069 TTAAAAATTGTGCTATTGGGCGG - Intergenic
950341462 3:12249330-12249352 TTAAAAATTTTCTTGTAAATAGG - Intergenic
950777984 3:15366811-15366833 TTAAAAATTATTTTATAGGTTGG - Intergenic
951544767 3:23813365-23813387 TTAAAATTTTTACTTTTGGTTGG + Intronic
951560669 3:23963386-23963408 TTAAAATTTTTGTTGTCACTTGG + Intronic
951869144 3:27340956-27340978 TTAAAAATTCATTTGTTTGTTGG - Intronic
952050055 3:29373939-29373961 TTAAAAATTCTGCTGGTGGATGG + Intronic
952102073 3:30025818-30025840 TCAAAAATGATGTTGTAGGTTGG - Intergenic
952266146 3:31788463-31788485 TTACAAATTTGGTGGTGGGTGGG + Intronic
953156617 3:40380988-40381010 TAAAAAAATTTTTTTTTGGTAGG - Intergenic
953229355 3:41050825-41050847 TTTAAAATTGTGTTCTTGCTTGG + Intergenic
953739946 3:45529163-45529185 TTAAAAATGATGTTGTAGGCCGG - Intronic
954159750 3:48712540-48712562 TTAAAAATTTTATTGTAGGCCGG - Intronic
954512646 3:51140060-51140082 CGAAAAAGTTTGTTGTTTGTTGG + Intronic
954673209 3:52301570-52301592 TTAAGAATTTTGGTATTGGCCGG + Intergenic
954805985 3:53220994-53221016 TTGGAAACTTTGTTGTTGTTGGG + Intergenic
954910909 3:54107602-54107624 TTTAAATTTTTGTTATTGTTTGG - Intergenic
955262301 3:57405333-57405355 TTATATGTTTTGTTGTTGTTAGG + Intronic
955276383 3:57551160-57551182 TTAAAAATTTTTGTTTTGGCTGG - Intergenic
955603691 3:60675700-60675722 TTAAAAAACATGCTGTTGGTAGG - Intronic
955990033 3:64616875-64616897 TTAGAAATTGTGTGGTTTGTTGG + Intronic
956107889 3:65840675-65840697 TTAAGGATTTTGGTGTGGGTGGG + Intronic
956122954 3:65984391-65984413 TTAAAAATTCTGTTGATACTGGG + Intronic
956164443 3:66385746-66385768 TTAAAAATCTAGTTATTGGCCGG - Intronic
956182844 3:66533523-66533545 TTAAAATTTTTATTTTTGGCTGG + Intergenic
956846231 3:73185610-73185632 TTAAAAATTATATTGGTGGCTGG - Intergenic
957343534 3:78931540-78931562 TTGAAAATGTTGTTTTTGGCTGG - Intronic
957511573 3:81195377-81195399 TTAAAAATTTATTTTTTGGGGGG - Intergenic
957715994 3:83929925-83929947 GTAAAAATTTTGTTGCCAGTTGG + Intergenic
957882004 3:86228874-86228896 TTAAAAATGTTGTCATTGGTTGG + Intergenic
957926081 3:86813350-86813372 TTCAACATTTTATTGTGGGTAGG - Intergenic
958460476 3:94388139-94388161 ATATATATTTTGTTGTTGGGTGG - Intergenic
958461575 3:94404448-94404470 TTATTAATTTTGTTTTTGGATGG + Intergenic
958476684 3:94592736-94592758 TAAAAAACTTTGTTTTTAGTGGG + Intergenic
958487133 3:94727192-94727214 TTGAAAATTTTGTTTTTTTTAGG + Intergenic
959188849 3:103083455-103083477 TTGAAATTTTTGTTGTTGTTTGG + Intergenic
959940317 3:112074301-112074323 TTAAAAGTTCTGTTGTTGCATGG - Exonic
960450021 3:117795123-117795145 TTAAAAATCCTGTTCTTGGTGGG - Intergenic
960473938 3:118100838-118100860 TTAAGAATCATGTTTTTGGTGGG + Intergenic
960477645 3:118148766-118148788 TTAAAAATTTTGTTTTTGTTGGG + Intergenic
960876689 3:122302953-122302975 TTAAAAATTCTTTTTTTGGGAGG - Intergenic
961023265 3:123528657-123528679 TTAAAAATATTATTGTTTTTAGG - Intronic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
961590132 3:127973155-127973177 TTAAGTATTTTGGTGGTGGTGGG - Intronic
961951534 3:130754561-130754583 TTAAAAATTTTTTTGTAGAATGG + Intergenic
962087989 3:132211759-132211781 TTAAAAATGTAGATCTTGGTCGG - Intronic
962553377 3:136520144-136520166 TTTAAAATTTTGTTATTTTTTGG - Intronic
962558548 3:136581145-136581167 TTAAAAATTATGTTCTTGTCTGG - Intronic
962694238 3:137931829-137931851 TTAAATAATTTATTGTTGGCTGG - Intergenic
962713955 3:138111208-138111230 TTAAAAATTCTGTTATTCTTAGG + Intronic
963101753 3:141613706-141613728 TTGCCAATTTTGTTATTGGTGGG + Exonic
963423300 3:145089765-145089787 TTAAAATTTTGGTTGTGGCTAGG - Intergenic
963488573 3:145968914-145968936 TTACTATTTTTGTTATTGGTGGG - Intergenic
963503592 3:146159087-146159109 TTACAAATTTCGGTGTAGGTAGG - Intronic
963707950 3:148712046-148712068 TTAAAAATATTAATATTGGTTGG - Intronic
963884992 3:150571678-150571700 TTAATAAATTTGTTTTTGGAAGG - Intronic
963950777 3:151198015-151198037 TTTAAAATTATGTTGCTGGTGGG + Exonic
964067393 3:152596476-152596498 TTTTAAATGTTGTTGTTGTTAGG - Intergenic
964191606 3:154008802-154008824 TTAAAAATTTTATCTTTTGTGGG - Intergenic
964334594 3:155641728-155641750 TTAAAAATTTTTTATTTGTTTGG - Intronic
964929190 3:161995695-161995717 GGTAGAATTTTGTTGTTGGTAGG - Intergenic
965877114 3:173338164-173338186 TTAAATATTTTGTTGTTTTTTGG - Intergenic
965978574 3:174657450-174657472 TTAAAAATTTTTTTGTGGCCGGG - Intronic
966530668 3:180975155-180975177 TTTAAAGCTTTGTTTTTGGTTGG + Intronic
966535490 3:181028556-181028578 TTAAAAATTTTGTTGCTTAGGGG + Intergenic
967341844 3:188407175-188407197 TTAATAATTTTTTTAATGGTGGG - Intronic
967690000 3:192463120-192463142 TAGAAGATTTTGTTGTTGGCAGG + Intronic
968496077 4:916516-916538 TTAAAAATTTTGTTGTTTTCTGG - Intronic
968547081 4:1204850-1204872 TTACAATTTTTGTTGCTGTTGGG + Intronic
969553471 4:7889085-7889107 CTAAAAATTTTGTTAATGGCAGG - Intronic
970271281 4:14350646-14350668 TTAACAAGTGTCTTGTTGGTAGG + Intergenic
970358836 4:15285954-15285976 TTTAAAAGTGTGTTGTTGGCTGG - Intergenic
970884424 4:20970715-20970737 TTAAACATTTTGTTTTAGGCAGG - Intronic
971026226 4:22590735-22590757 TTTAAAATTTTGTTTTGAGTTGG + Intergenic
971033556 4:22667657-22667679 CTAAAAATGATATTGTTGGTAGG - Intergenic
971225173 4:24745331-24745353 TTTAAAAATATGTTGTTGGTTGG + Intergenic
971711653 4:30120481-30120503 TCCAAAAATTTGTTGGTGGTGGG - Intergenic
971712852 4:30139152-30139174 TTAAAAATGTTGATGTTTGCCGG - Intergenic
971728256 4:30341361-30341383 TATAAAATTTTGTTGATTGTTGG + Intergenic
971729155 4:30353762-30353784 ATAAAAATAATTTTGTTGGTAGG + Intergenic
972243802 4:37223436-37223458 TTAAAAATGTTGTTTTCGGCCGG - Intergenic
972502642 4:39692884-39692906 TTTAAAAATTTGTTTTTGGATGG + Intergenic
972546675 4:40086629-40086651 TTAAATATTTTTTATTTGGTCGG - Intronic
972781879 4:42293321-42293343 TTATAAATTGTGGTGCTGGTGGG - Intergenic
973254831 4:48099535-48099557 TAAAAAATCTTCCTGTTGGTTGG - Intronic
973561627 4:52142852-52142874 TAAAAAATTTTGATTTTTGTGGG + Intergenic
974399408 4:61383417-61383439 TTAAAAATATTGCTGTTGTGAGG + Intronic
974538425 4:63199583-63199605 TTAAAAATATTGTTATTTTTTGG + Intergenic
975086886 4:70352312-70352334 CTAAAACTATTGTTGCTGGTTGG - Intergenic
975125234 4:70774850-70774872 ATAAAAATTTTCTTGTTAATAGG - Intronic
975133910 4:70855979-70856001 TTAAAAATTGTGTTACTGGCCGG + Intergenic
975427250 4:74244896-74244918 TTAAGAATCTAGTTGTTGGCCGG + Intronic
975543821 4:75541417-75541439 TTATAAATTGTTTTGTAGGTAGG - Intronic
975566597 4:75762455-75762477 TTAAAAATATTGTTCTGGCTGGG - Intronic
975606610 4:76161436-76161458 ATAGTAATTTTGTTGTTGTTGGG - Exonic
975797027 4:78017483-78017505 TTTACCATTTTGTTGTTGTTTGG - Intergenic
975931240 4:79525691-79525713 TTAACTATTTTGTTGTGGGTAGG + Intergenic
975987465 4:80214748-80214770 TTTAAAATTAAGTTATTGGTTGG + Intergenic
976588508 4:86825577-86825599 TGAAACATTTTCTTTTTGGTAGG - Exonic
976754907 4:88487749-88487771 TAAAATATTTTGTTAATGGTTGG - Intronic
976814853 4:89136113-89136135 TTAAAAATTGTGTTATTATTTGG + Intergenic
976904353 4:90217965-90217987 TTAAAATTTTTATTGTATGTAGG + Intronic
977791526 4:101110127-101110149 TTAAAAATTTTGTGCTTGAATGG + Intronic
977812336 4:101371273-101371295 TAAAAAATTTTTTTGTGTGTGGG + Intergenic
978927499 4:114266419-114266441 TAAAAAATTTTTTTGTAGATGGG + Intergenic
979528278 4:121740680-121740702 TTTTTATTTTTGTTGTTGGTTGG - Intergenic
979657538 4:123213369-123213391 ATAAGATTTTTGTTGTTGTTAGG - Intronic
980142568 4:128938283-128938305 CCAAGAATTTTGTTGTTGTTGGG - Intronic
980381669 4:132028513-132028535 TTAGTAATTTTGTTTTTGGTGGG - Intergenic
980509271 4:133763435-133763457 TTAAGAATTTAATTATTGGTTGG + Intergenic
980824471 4:138057198-138057220 TTAAAATTTTTGGTGGTGGGGGG - Intergenic
981121205 4:141052669-141052691 TTAAAGATTTTGTTGTGACTGGG - Intronic
981603472 4:146518411-146518433 TGATAATTTTTGTTGTTGGAGGG - Intronic
981711386 4:147712275-147712297 TTAAGACTTTTGTTGTTTTTTGG - Intergenic
981805194 4:148707210-148707232 TTACTAATTTTTTTTTTGGTGGG + Intergenic
981871326 4:149489928-149489950 TTAAAATTTTTGTTTTTGTTTGG + Intergenic
981896935 4:149813130-149813152 ATAAAAATTTTCTTGTTTGGGGG - Intergenic
982014463 4:151139475-151139497 TTAAAAAGTTTGTGACTGGTAGG + Intronic
982446524 4:155496947-155496969 TAAAAAATTTTGTAGGTGGTAGG + Intergenic
982548813 4:156770706-156770728 TTAAAAATAATGATTTTGGTTGG - Intronic
982612550 4:157594559-157594581 TTATAATTTTTGTTGATAGTAGG + Intergenic
982814875 4:159872127-159872149 TTAAAAATTTTTTTGTAGGCCGG - Intergenic
983028155 4:162763489-162763511 TGAAAAATTGTGTTGAAGGTAGG - Intergenic
983386114 4:167064191-167064213 TTAAAAAATTTGAAATTGGTGGG - Intronic
983551740 4:169024884-169024906 GTATAATTTTTGTTGTTGTTGGG + Intergenic
983744528 4:171180977-171180999 TTAAATACTTTTTTCTTGGTGGG + Intergenic
983758360 4:171371389-171371411 TTTAAAATGTTTTTGTTTGTGGG - Intergenic
983994406 4:174163697-174163719 TTAAAGAATTTGGTGTTAGTGGG - Intergenic
984334319 4:178369384-178369406 GGAAAAATCTTCTTGTTGGTTGG - Intergenic
984392713 4:179157324-179157346 TTAAAAATATTATTGTTGGCCGG - Intergenic
984621578 4:181959126-181959148 TTCAAAAAATTGTTGTTGTTTGG + Intergenic
984765817 4:183399624-183399646 TTTAAAATTTTGTATTTGGTCGG - Intergenic
984782309 4:183537025-183537047 TTAAAAATATTTATATTGGTCGG - Intergenic
986952662 5:13109788-13109810 TCACAAATTTTGTTTTTGATTGG - Intergenic
987966186 5:24878357-24878379 GTAAAAATTTTGTTGCTAGGTGG + Intergenic
987978576 5:25048536-25048558 TGAGAAATTTTGTTGCTAGTAGG + Intergenic
988128089 5:27068869-27068891 CTAAAAATTTTATGGCTGGTAGG - Intronic
988313886 5:29598616-29598638 TAAAAAATATTGTTGTGGGACGG - Intergenic
988495299 5:31740222-31740244 TTGAAAATTCTGCTGTTGGCTGG + Intronic
989010204 5:36862866-36862888 TTAAAAATATCTTTGTTGGCTGG + Intergenic
989366393 5:40660444-40660466 TTAAAAATAATGCTGTTGGCTGG - Intergenic
989700007 5:44252658-44252680 TGAAAAATTGGGTTGTTGATTGG + Intergenic
989843949 5:46115878-46115900 TTAAAAAATTAGTTGTTGCAAGG - Intergenic
990196752 5:53325742-53325764 TTAAAAATTTTTTTAAAGGTGGG + Intergenic
990408331 5:55514465-55514487 TTTAAAATTTTTTTTATGGTGGG - Intronic
990567552 5:57044256-57044278 TTTAAAATTTTGGTTTTGGCAGG + Intergenic
990662494 5:58032774-58032796 TTAATTATTTTGTTGTAGGGAGG - Intergenic
990802486 5:59620471-59620493 TTTAAGATTTTGAGGTTGGTTGG + Intronic
991219045 5:64190829-64190851 TTCAAAATTAAGATGTTGGTAGG - Intronic
991264034 5:64695965-64695987 TTTAAAATTTTGATTTTGGATGG + Intronic
991424020 5:66472286-66472308 TTAAAAGTTTTTTTTTTGTTGGG + Intergenic
991729669 5:69572637-69572659 TTAACAATTTTGTTATAGCTGGG - Intronic
991806101 5:70427777-70427799 TTAACAATTTTGTTATAGCTGGG - Intergenic
991865287 5:71055243-71055265 TTAACAATTTTGTTATAGCTGGG + Intronic
991956389 5:71999319-71999341 TTTAAATTTTTCTTTTTGGTAGG + Intergenic
992543141 5:77784115-77784137 TCAATCATGTTGTTGTTGGTAGG - Intronic
992614013 5:78532564-78532586 TTAAAAGTTTTGTTGTTTCCAGG - Intronic
992697069 5:79300112-79300134 TTAAAAAATTTCTAGCTGGTGGG - Intronic
993082078 5:83313992-83314014 GTAAAGATTGTGTTCTTGGTTGG - Intronic
993334092 5:86635222-86635244 TTAAAAGTTTTGTTCCTGGCTGG + Intergenic
993405192 5:87503011-87503033 GTGAGATTTTTGTTGTTGGTAGG - Intergenic
993529616 5:89007973-89007995 TTAAAAATTTTATTCTGGGCCGG + Intergenic
993533774 5:89055763-89055785 TTAAAAACTTTGTCATTGGATGG + Intergenic
993806616 5:92418529-92418551 TAAGAAATTTTTTTGTAGGTTGG - Intergenic
993933719 5:93974626-93974648 ATATATATTTTGTTGTTGTTGGG - Intronic
993941465 5:94063387-94063409 TTCACGATTTTGTTGATGGTAGG - Intronic
994292002 5:98038476-98038498 TTAAAAATATTTTTGTTTGTTGG - Intergenic
994571181 5:101516002-101516024 TTCAAAATCTAGTTGTTAGTGGG - Intergenic
995101472 5:108312241-108312263 TTAAAAATTGTGTTTTTTATGGG - Intronic
995203270 5:109449834-109449856 TTTAAAAGTTTGTTATTGGCTGG - Intergenic
995327126 5:110903443-110903465 GTAAAAAATTTATTTTTGGTTGG + Intergenic
995333000 5:110966541-110966563 TGAAAAATTTTGTCTTTGGAAGG + Intergenic
995727166 5:115193200-115193222 TTAAAAATCATGTTCTTGGCCGG - Intergenic
995856117 5:116594175-116594197 TTAAGAATTTTTTTTTAGGTAGG - Intergenic
995986099 5:118176014-118176036 TTAAAAATATTATTTTGGGTTGG - Intergenic
996344246 5:122472343-122472365 CAAAAAATTTTGCTGTTTGTAGG + Intergenic
996807112 5:127468343-127468365 TTAAAAATTTTTTAGTGAGTTGG - Intergenic
997040171 5:130243707-130243729 TTAAAGATTTTTTTGATGGCAGG + Intergenic
997124632 5:131213348-131213370 TACATAATTTTGTTGTGGGTAGG + Intergenic
997142260 5:131395058-131395080 TTAAAAATCATGTGGTTGATAGG - Intronic
998636352 5:143959162-143959184 TTAAAAATATGATTGTTGGGTGG + Intergenic
998653691 5:144150644-144150666 TTAAATATTTTGTCCTTGGCTGG - Intergenic
998985256 5:147749887-147749909 TTATAAATGTTTTTGTTTGTTGG + Intronic
999308516 5:150536187-150536209 TTAAAAATTTTTTTCTTGGCTGG + Intronic
999579768 5:153024752-153024774 TTAAAAATTTTTATTTTTGTAGG - Intergenic
1000464193 5:161554842-161554864 TAAAAAATTGTGTTTTTTGTTGG + Intronic
1001993841 5:176138133-176138155 TTAAAAACTTAGTTGTTGGCCGG - Intergenic
1002870602 6:1164149-1164171 TTACCAATTTTTTTGCTGGTGGG - Intergenic
1003604931 6:7550942-7550964 TTAAAAATTTCTTTGAGGGTAGG + Intronic
1003801452 6:9673462-9673484 TTAAAATTTTTATTTTTTGTGGG + Intronic
1003909388 6:10729479-10729501 TAAAAAATTTAGTTGTGGCTGGG + Intronic
1004256752 6:14071485-14071507 TAAAAAAGTTAGTTGTTGCTCGG + Intergenic
1004336401 6:14768408-14768430 TTAAAAATCTCTTTGTTGGCTGG - Intergenic
1004574360 6:16880190-16880212 TTAAGAATTTTTATGTTGGCTGG + Intergenic
1005367890 6:25097799-25097821 TTAAAAATCTACTTGTTGGCTGG + Intergenic
1005416125 6:25602142-25602164 TAAATAATGTTGATGTTGGTGGG - Intronic
1005566556 6:27101510-27101532 TTAAAACATTTGTTGGCGGTTGG + Intergenic
1006253401 6:32809936-32809958 TTAAACATTTTTTTTTTAGTGGG - Intergenic
1006492857 6:34399519-34399541 TTAAAAAATAGGTTGTTGGCCGG - Intronic
1006759126 6:36443520-36443542 TTAAAAATTAGGTAGTTGGTGGG + Intronic
1007368485 6:41410700-41410722 TGAAAAAGTTTGTTGTCTGTAGG + Intergenic
1007564036 6:42834838-42834860 TTAAAAAAATAGTTGATGGTAGG - Intronic
1008137100 6:47789510-47789532 TTGAAAAATTTGTTGTTGAATGG + Intronic
1009432137 6:63575984-63576006 GTAAAAATGTTTTTGTTAGTTGG + Intronic
1009695106 6:67092637-67092659 TTAAAAATTGTGTGGTTTGGGGG + Intergenic
1009958797 6:70493754-70493776 TTAAAAATGATGTTTTTGGCCGG + Intronic
1010038137 6:71350323-71350345 TTAAAAATTTCCTAGTTTGTTGG + Intergenic
1010113595 6:72272763-72272785 TTAAAACTTTTGGTGTTATTTGG - Intronic
1010405692 6:75503569-75503591 TTAAAAATTGTCTTGCTAGTTGG - Intergenic
1010439329 6:75875270-75875292 TTAAAAATTTTTTTTTGGTTGGG + Intronic
1011253814 6:85401277-85401299 TTGAAAATTCTGTTCTTGGAAGG - Intergenic
1011604524 6:89089600-89089622 TTAAAAATCTTACTGTTAGTAGG - Intergenic
1011857466 6:91712663-91712685 TTAAAAATATAGTTGTTTGTTGG + Intergenic
1012296258 6:97528507-97528529 TTAAAAATATTGGTGTTTGCTGG + Intergenic
1012302069 6:97602026-97602048 TTAAAATTTTTATTTTTGGCAGG - Intergenic
1012704551 6:102504772-102504794 TTAAACATTTTCTTGTTATTTGG + Intergenic
1012713242 6:102635299-102635321 TTACACATTTTGTTGTTTGGAGG + Intergenic
1012818747 6:104058124-104058146 CTAAAAATTTTGATGTTGGCTGG + Intergenic
1013137678 6:107298038-107298060 TTTAAAATTTTGTTTCTGGCTGG - Intronic
1015197986 6:130544942-130544964 TTAAGCATTTTTTGGTTGGTCGG - Intergenic
1016137106 6:140557360-140557382 TTAAACATTTTCTTGATGGCTGG + Intergenic
1016861657 6:148725976-148725998 TTGGAAATTTTTTTTTTGGTAGG - Intergenic
1016873457 6:148841058-148841080 TTTACAATTTTGTTTTTGTTGGG - Intronic
1017114593 6:150965276-150965298 TAAAAATTTTTTTTTTTGGTTGG - Intronic
1018300231 6:162394397-162394419 TTAAAAATGTTTGAGTTGGTAGG - Intronic
1020808587 7:12822956-12822978 TTTAAAATTTTGTTTCTGGCAGG - Intergenic
1020894455 7:13922377-13922399 TTAAAAATTGTATTATTGCTGGG - Intronic
1020935204 7:14455082-14455104 TTAAAAAGTATATTGATGGTTGG - Intronic
1020974959 7:14993993-14994015 TTGAAGATATTGTTGTTGTTAGG - Intergenic
1021278458 7:18685870-18685892 GGCAAAATTTTATTGTTGGTAGG + Intronic
1021629417 7:22629810-22629832 TTAAATGTTTTGTTGTTGGCTGG - Intronic
1021713118 7:23436050-23436072 TAAAAAATTTAGATGTTGGCCGG - Intronic
1022444845 7:30461476-30461498 TTAATAAATTTTTTGTTGATGGG - Intronic
1022755917 7:33289696-33289718 TTAAAAATTTTCTTGTAAATGGG + Intronic
1023003499 7:35838144-35838166 ATTATTATTTTGTTGTTGGTAGG + Intronic
1023295013 7:38705668-38705690 TTTAAAAATTTTTTTTTGGTGGG - Intergenic
1023396456 7:39756168-39756190 TTAAAAACTTAATTGTTGGTGGG + Intergenic
1023614732 7:42008355-42008377 TTCAAATATTTGTTGGTGGTTGG - Intronic
1024161511 7:46681216-46681238 TTATATATTTCGTTGTTGGCTGG + Intronic
1024647023 7:51379423-51379445 TTTAAAAATTTTTTATTGGTGGG - Intergenic
1024796128 7:53023405-53023427 TTAAAACTTTTATTTTTGGGAGG + Intergenic
1025076730 7:55950353-55950375 TTAGAAAGTTTGTTTTTAGTCGG + Intergenic
1025111967 7:56224855-56224877 TTAAAATTTTTGTAGAGGGTCGG + Intergenic
1025630740 7:63270439-63270461 TTACAAATTTTTTTTTTTGTGGG - Intergenic
1025756226 7:64345432-64345454 CTCAAAAGTGTGTTGTTGGTTGG + Intronic
1026062776 7:67040865-67040887 TTAAAAACTTTGTTTATAGTGGG + Intronic
1026217336 7:68361315-68361337 TAAAAAATGTTTTTGTTGGCTGG - Intergenic
1026384513 7:69832809-69832831 TTAATGTTTTTGTTGTTGTTAGG - Intronic
1026478680 7:70760299-70760321 TTAAAAATCTTTTTGTAGGCCGG - Intronic
1026526240 7:71155898-71155920 TTAAAAATTTCATTCTTGGCTGG + Intronic
1026715573 7:72786540-72786562 TTAAAAACTTTGTTTATAGTGGG - Intronic
1028094236 7:86740580-86740602 TTAAAAATTTAGTTGGTTTTGGG - Intronic
1028214920 7:88119783-88119805 TTAAAAATTGTGTTATAGGCCGG - Intronic
1028413988 7:90560321-90560343 TTAAAAATCATCTTGTTGGCTGG + Intronic
1028686691 7:93597883-93597905 TTAAAAATCTTCTTGTTAATTGG - Intronic
1029101327 7:98132543-98132565 TTAAAAAATGAGTTGGTGGTTGG - Intronic
1029326644 7:99815281-99815303 TTAAAATTTTTATTTTTGGTGGG - Intergenic
1029429332 7:100519670-100519692 TTAAAACTTATGTTTTAGGTTGG + Intergenic
1029791521 7:102847823-102847845 ATAAAAATTGGTTTGTTGGTTGG - Intronic
1030024614 7:105311184-105311206 TTATTTATTTTTTTGTTGGTGGG - Intronic
1030076055 7:105737828-105737850 TTAAGAATTTTGTGGCTGGAAGG + Intronic
1030611153 7:111690589-111690611 TTAAGAAGTTTGTTATGGGTGGG - Intergenic
1030645976 7:112062225-112062247 TTAAAAATATTGAGGTTGGTGGG - Intronic
1030734347 7:113027650-113027672 TTAAAAAATTATTTTTTGGTTGG - Intergenic
1030798749 7:113822698-113822720 TTAAAAATAGTTTTGTAGGTTGG - Intergenic
1031073773 7:117192590-117192612 TTAAGAATTTTGATAATGGTTGG + Intronic
1031186716 7:118490391-118490413 ATTAACATTTTGTTGTTGGAGGG - Intergenic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1031318394 7:120287840-120287862 TTAAATGTTCTGTTGTTGTTGGG - Intronic
1031847668 7:126825634-126825656 TTACAACTTTTTTTCTTGGTAGG - Intronic
1031898451 7:127382402-127382424 TTTAAAATTTTGTTTTGGTTTGG + Intronic
1031946058 7:127841737-127841759 TTAAAAACCTTTTTGTTGGAGGG + Intronic
1032906461 7:136373168-136373190 TTGTAAATTTTCTTGTAGGTTGG - Intergenic
1034080413 7:148272161-148272183 TCTAAAAGTTTGCTGTTGGTTGG - Intronic
1034373349 7:150620915-150620937 TTGAAAATTTTGTTGTGCCTTGG - Intergenic
1034579095 7:152026951-152026973 TTAAAAATTTTTTTATTAGCCGG + Intronic
1035541557 8:443359-443381 CTACAAATTATCTTGTTGGTAGG - Intronic
1037282855 8:17262764-17262786 TTAAAAATTATATTGTAGGCCGG + Intronic
1038091560 8:24259603-24259625 TGAGACATTTTGTTGTTGGTAGG - Intergenic
1039353671 8:36791584-36791606 TGAAAACTGTTGTTGTTGCTAGG - Intronic
1039485607 8:37907359-37907381 TTAAAAATCTTGTTACTGGCTGG - Intergenic
1039615136 8:38949577-38949599 ATAAAATTTTTATTGTTAGTTGG - Intronic
1039648391 8:39312619-39312641 GTAAATATTTTGTGGGTGGTTGG + Intergenic
1039932575 8:42007664-42007686 TTAAAATTTTTATTGTTGGCCGG + Intronic
1040380176 8:46864847-46864869 CTAAAAATGTGGCTGTTGGTTGG + Intergenic
1040972952 8:53157195-53157217 TTTAAAGATATGTTGTTGGTGGG - Intergenic
1041119131 8:54568894-54568916 TTAAATAACTTATTGTTGGTTGG - Intergenic
1041777034 8:61534711-61534733 TTAAATATTTTCTTGTATGTGGG + Intronic
1041985220 8:63914482-63914504 TTTTAAATTTTGTATTTGGTTGG - Intergenic
1042151072 8:65784723-65784745 TTAAAATTTTTTTTTTTGGTGGG - Intronic
1042265206 8:66901633-66901655 TTAAAAATGTGGCTGTTGGGCGG + Intronic
1042725360 8:71869156-71869178 ATAAAGCTTTTGTTGATGGTTGG - Intronic
1043145593 8:76649560-76649582 TTAAAAATTTTAATTTTTGTAGG - Intergenic
1043189916 8:77205731-77205753 TTAAAAATTTTGTATTTAATAGG - Intergenic
1043256375 8:78142841-78142863 TTAAAAATAGTGTTGTGGGCTGG - Intergenic
1043270544 8:78328025-78328047 TTAAGAATTTTGATATTGTTTGG - Intergenic
1043463485 8:80483850-80483872 TTAAAAATTTTTATTTTGCTGGG - Intergenic
1043670101 8:82873835-82873857 TTAATATTTTGTTTGTTGGTTGG - Intergenic
1043946354 8:86257945-86257967 TTAAAAATTTCTTTCTGGGTGGG + Intronic
1044027141 8:87187011-87187033 TTCAATATTTTCTTCTTGGTAGG - Intronic
1044259513 8:90101390-90101412 TAAAAAAATCTGTTGTTGGCTGG + Intergenic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1044807915 8:96027597-96027619 GTAATAATCTTTTTGTTGGTTGG - Intergenic
1044841710 8:96342730-96342752 TTAAACAGTTTGTTAGTGGTAGG - Intergenic
1044944196 8:97375701-97375723 TTTAAAATCTTGGTGTTGGGGGG - Intergenic
1045170372 8:99659978-99660000 TTAAAAAGTCTGTTGCTGGTAGG - Intronic
1045209304 8:100079189-100079211 TTAAAAATTTTTTACTAGGTGGG - Intronic
1045338432 8:101230478-101230500 TTAAAAATGCTGTTGTGGGCCGG + Intergenic
1045468265 8:102488921-102488943 TTAAAAATTTTTTTATAGCTGGG + Intergenic
1045782538 8:105884628-105884650 TTTAAAATTTTGTAGTTAGTAGG - Intergenic
1046156515 8:110297468-110297490 TAAGAAATTCTGTTGCTGGTTGG + Intergenic
1046171338 8:110511408-110511430 TTAAAAATTTTTTTGTTAACTGG - Intergenic
1046381607 8:113458160-113458182 CTAAAAATTTTGTTGGTAGTTGG - Intergenic
1046402357 8:113720413-113720435 TTAAAAATTTTGTCTTTGGTAGG + Intergenic
1046960282 8:120104403-120104425 TTAAAAATATTGTTTTGGGTTGG - Intronic
1047257041 8:123221901-123221923 TTAAAATTTTTTTTGGAGGTGGG - Intronic
1047293432 8:123550106-123550128 TTAAAAATTTCATTTTTGCTGGG - Intergenic
1047565926 8:126043504-126043526 TTAGAACTTTTTTGGTTGGTAGG + Intergenic
1047604731 8:126463969-126463991 TTAAAATTTTTATTTTTGGCTGG + Intergenic
1047792096 8:128214054-128214076 TTATAATTTTGTTTGTTGGTTGG + Intergenic
1048155795 8:131949506-131949528 TTAAAAAGTTTCTTTTGGGTTGG + Intronic
1048676762 8:136792712-136792734 TTAAAAATTTTGTTACAGATGGG + Intergenic
1049089922 8:140506952-140506974 TTAAAAATTTTGCTTTAGGCAGG - Intergenic
1050166397 9:2769203-2769225 TCAACCATTTTCTTGTTGGTGGG - Intronic
1050206638 9:3203414-3203436 TTAAAAATCTAGATGTTGGCCGG + Intergenic
1050229242 9:3501214-3501236 TTAAAAATTTTCTTTTAGGAAGG - Intronic
1050266033 9:3890778-3890800 TCAAAAGTAGTGTTGTTGGTGGG - Intronic
1050389086 9:5118526-5118548 TTAAAAATTTTATTGGTGAATGG + Intronic
1050411223 9:5367768-5367790 TTGATAGTTTTGTTGTTGTTGGG - Intronic
1050968240 9:11835619-11835641 TTAAAAATTCTTTTGATGGTGGG + Intergenic
1051210084 9:14732281-14732303 TTTAAAACTTTGTTATTAGTAGG + Intergenic
1051487020 9:17619721-17619743 TTAAACATTCTTTTGTTGTTGGG + Intronic
1052257735 9:26478809-26478831 TTCAGAATTTTACTGTTGGTTGG - Intergenic
1052278856 9:26709859-26709881 TTAAAAAATGTGTATTTGGTTGG - Intergenic
1052371850 9:27674458-27674480 TTAAGAATTTTGTTTTTTGGAGG + Intergenic
1052762651 9:32608601-32608623 TTAAAAAATTTATTATTGGAGGG - Intergenic
1052874229 9:33541405-33541427 TTGAAAATATTGGTGTTGCTGGG + Intronic
1052921870 9:33977331-33977353 TTAAAAATTTTTTGTTTGGCTGG - Intronic
1053501813 9:38602960-38602982 TTGAAAATATTGGTGTTGCTGGG - Intergenic
1054778455 9:69144160-69144182 TTAAAAATTTGAGTGTTGCTGGG - Intronic
1055045094 9:71915470-71915492 TTAAAAATATTTTTGTAGCTGGG - Intronic
1055322148 9:75092774-75092796 TGAAAAGTCTTGCTGTTGGTTGG + Intronic
1055327684 9:75148971-75148993 TTGCACATTTTGTTGTTGTTGGG + Intergenic
1055472419 9:76626252-76626274 TTATAAATTTGGTTCTAGGTTGG + Intronic
1056312016 9:85350366-85350388 TAAAAAAATTGGTTTTTGGTGGG - Intergenic
1056340727 9:85629009-85629031 TTCAAAACTCTGTTGTTGGCTGG - Intronic
1056380937 9:86056798-86056820 TTAAAAAATTTTTTTTTGGCTGG - Intronic
1056490787 9:87104900-87104922 TGAAAAATTTGGTTTTTGGGAGG - Intergenic
1056944251 9:90980242-90980264 TTAAAAATTTTTTTTCTAGTAGG - Intergenic
1057334191 9:94142951-94142973 TTAAAAATATTGTGGTAGGCTGG - Intergenic
1058285801 9:103176650-103176672 TTAAAAAATCTGTTGTTGGCTGG + Intergenic
1058335902 9:103828709-103828731 TGAAAGTTTTTGTTGTTGTTGGG + Intergenic
1058477658 9:105355000-105355022 TTAAAAATGTAGTTGTAGCTGGG + Intronic
1058559254 9:106206892-106206914 ATAAAAATGTTGTAATTGGTCGG - Intergenic
1059258914 9:112957083-112957105 TTTAAAAATCTGCTGTTGGTGGG + Intergenic
1059593318 9:115688503-115688525 TTTTAAATTTTGATGTTGTTTGG + Intergenic
1059597013 9:115731859-115731881 TTTTAAATTTTGATGTTGTTTGG + Intergenic
1059792603 9:117656680-117656702 TTATAAATGTTGTTATTGATAGG + Intergenic
1060125059 9:121035874-121035896 TTAAACATTTTTTTGTAGGCTGG - Intronic
1060277047 9:122190319-122190341 ATAAAAATTTTGCTGTTGCTTGG + Intronic
1060376899 9:123123515-123123537 TTTTTAATTTTGTTGTTTGTTGG - Exonic
1060675316 9:125508823-125508845 TTAAAAATTTTTTTGGAGATAGG - Intronic
1061349923 9:130056012-130056034 TAACAACTTTTGTTGTTTGTAGG + Intronic
1061468884 9:130806852-130806874 TTAAAAAATTTGTTTTTGGCTGG + Intronic
1061491424 9:130946895-130946917 TTAACCATTTTCCTGTTGGTGGG + Intergenic
1186059218 X:5685622-5685644 TTAAAAATTGTGTTTGTTGTTGG - Intergenic
1186190339 X:7061782-7061804 TTATAAAATTTGAAGTTGGTGGG - Intronic
1186202988 X:7172794-7172816 TTACCAATTTTGTTATTTGTAGG - Intergenic
1186635899 X:11404594-11404616 TTAAAAAGTTTTGTGTTTGTGGG + Intronic
1186917350 X:14237901-14237923 TTAAAAATTTTGGTAGAGGTGGG - Intergenic
1187113056 X:16321211-16321233 TTAAAAATGTTTTTGAAGGTTGG + Intergenic
1187650528 X:21399281-21399303 TTAAAGATTTTGTTTTTTATAGG - Intronic
1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG + Intergenic
1188216259 X:27481079-27481101 TTAAGAATTTTGGTATTGGCCGG + Intergenic
1188372475 X:29386000-29386022 TTAAAAAGTGTGTTGGGGGTTGG - Intronic
1188460568 X:30422276-30422298 TAAAAAAAATTGTTTTTGGTTGG - Intergenic
1188900353 X:35724806-35724828 TTAAAAGTTTTGGTGTATGTTGG - Intergenic
1188947164 X:36319766-36319788 TATAAATTTTTGTTGTTGTTTGG + Intronic
1189069092 X:37845872-37845894 TTTAAAATCTTGTTCTTGGCCGG + Intronic
1189862553 X:45288692-45288714 TTAAAAGTCTTGCTGCTGGTAGG + Intergenic
1190194806 X:48307686-48307708 TTAAAAATATTAGTGGTGGTGGG - Intergenic
1190378839 X:49818281-49818303 TTAAAACTTTTGTTTTATGTGGG - Intergenic
1190464274 X:50710007-50710029 TTAATATTATTGTTGCTGGTTGG - Intronic
1190575679 X:51835111-51835133 TTTAAAATTTCGTTGTGGGAAGG + Intronic
1190661239 X:52655943-52655965 TTAAAAATATTAGTGGTGGTGGG - Intronic
1190839457 X:54130791-54130813 TTAAAAATCTTTGTGTTGTTAGG + Intronic
1191819318 X:65285592-65285614 AAAATAATTTTGTTGTTGGGTGG - Intergenic
1191905395 X:66082582-66082604 TTTAAACTTTTGTTGTTTGGGGG + Intergenic
1192057238 X:67785369-67785391 ATAAACATTTTGTTTTTGATGGG + Intergenic
1192861114 X:75071924-75071946 TTGAAGATTTTGTTTTAGGTCGG - Intronic
1193021926 X:76800818-76800840 TTAAATAGTGTGTTGCTGGTCGG - Intergenic
1193115656 X:77772781-77772803 TAAAAAAGTTTGTTTTTGGCTGG - Intronic
1193129922 X:77908820-77908842 ATATATATTTTGTTGTTGTTTGG - Intergenic
1193322402 X:80138265-80138287 TAAGAAATTTTGTTTTTGGCCGG + Intergenic
1193449526 X:81648440-81648462 TTAACGATTTTGTTGTTCATTGG - Intergenic
1193738862 X:85193904-85193926 TTATACAATTTGTCGTTGGTGGG + Intergenic
1193855155 X:86591432-86591454 TAAAAAATTGTAATGTTGGTGGG - Intronic
1194043667 X:88973580-88973602 TTAAAAATATTAGTGTTTGTAGG - Intergenic
1194461441 X:94174720-94174742 TAAAGAATATGGTTGTTGGTGGG - Intergenic
1195158242 X:102143537-102143559 TTAAAAATTTTCTAGTTCTTTGG - Intergenic
1195284943 X:103375460-103375482 TTTAAAATTTTATTTTTGGCCGG - Intergenic
1195607311 X:106821919-106821941 TGAAATATATTTTTGTTGGTAGG + Intronic
1195761572 X:108251833-108251855 TTAAAAGTTTTGTTTTTAATTGG + Intronic
1196254147 X:113496116-113496138 TTCAAAATTCTGTTATTGCTTGG - Intergenic
1196635805 X:118001376-118001398 TGAAAAATTTTGTTGTTGGATGG - Intronic
1196903679 X:120411114-120411136 TTAAATATTTTAGTGGTGGTGGG - Intergenic
1197690927 X:129500460-129500482 TTAAAAATCTTGTTGTGGGCTGG - Intronic
1197842331 X:130762284-130762306 TTAAAATTTTTATACTTGGTTGG + Intronic
1198209224 X:134501199-134501221 TTAAAAAGTTTGCTGTAGGCCGG + Intronic
1199034293 X:143032693-143032715 TTGAAAGTTTTGTTGTTTGGAGG + Intronic
1199277270 X:145961093-145961115 TAAAGAATTTTTTTTTTGGTGGG + Intergenic
1199398159 X:147365201-147365223 TTAAAAATTTTCTTGTAAATAGG - Intergenic
1200313497 X:155105185-155105207 TTAAAAAGTTTGTGTTAGGTGGG + Intronic
1200425019 Y:3010365-3010387 TTAAAAGTTTTCTTATTGTTTGG - Intergenic
1200554513 Y:4618779-4618801 ATATATATTCTGTTGTTGGTGGG - Intergenic
1201489855 Y:14528249-14528271 TTAAAAATATTGTTGGGGTTAGG - Intronic
1201860356 Y:18591037-18591059 TTTTTAACTTTGTTGTTGGTAGG + Intergenic
1201872967 Y:18729344-18729366 TTTTTAACTTTGTTGTTGGTAGG - Intergenic