ID: 944760553

View in Genome Browser
Species Human (GRCh38)
Location 2:202809399-202809421
Sequence CAGTACTTCGAGAGGCCAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5519
Summary {0: 1, 1: 4, 2: 146, 3: 1736, 4: 3632}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944760546_944760553 -6 Left 944760546 2:202809382-202809404 CCCCACGCCTGTAATCCCAGTAC 0: 27
1: 1090
2: 2848
3: 2710
4: 2550
Right 944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG 0: 1
1: 4
2: 146
3: 1736
4: 3632
944760545_944760553 6 Left 944760545 2:202809370-202809392 CCAGGTGCAGTACCCCACGCCTG 0: 1
1: 7
2: 368
3: 9068
4: 43732
Right 944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG 0: 1
1: 4
2: 146
3: 1736
4: 3632
944760548_944760553 -8 Left 944760548 2:202809384-202809406 CCACGCCTGTAATCCCAGTACTT 0: 30
1: 1315
2: 3683
3: 3495
4: 2765
Right 944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG 0: 1
1: 4
2: 146
3: 1736
4: 3632
944760547_944760553 -7 Left 944760547 2:202809383-202809405 CCCACGCCTGTAATCCCAGTACT 0: 28
1: 1207
2: 3363
3: 3196
4: 2441
Right 944760553 2:202809399-202809421 CAGTACTTCGAGAGGCCAAGCGG 0: 1
1: 4
2: 146
3: 1736
4: 3632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944760553 Original CRISPR CAGTACTTCGAGAGGCCAAG CGG Intronic
Too many off-targets to display for this crispr