ID: 944763445

View in Genome Browser
Species Human (GRCh38)
Location 2:202840715-202840737
Sequence CAGCTCGGAGAGCTTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 13, 3: 24, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944763438_944763445 5 Left 944763438 2:202840687-202840709 CCTGCTTGGCCCGCTGCAGGGCA 0: 3
1: 10
2: 22
3: 34
4: 198
Right 944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG 0: 1
1: 1
2: 13
3: 24
4: 140
944763440_944763445 -5 Left 944763440 2:202840697-202840719 CCGCTGCAGGGCAGCCTCCAGCT 0: 3
1: 13
2: 19
3: 90
4: 529
Right 944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG 0: 1
1: 1
2: 13
3: 24
4: 140
944763439_944763445 -4 Left 944763439 2:202840696-202840718 CCCGCTGCAGGGCAGCCTCCAGC 0: 5
1: 16
2: 23
3: 87
4: 556
Right 944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG 0: 1
1: 1
2: 13
3: 24
4: 140
944763435_944763445 11 Left 944763435 2:202840681-202840703 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG 0: 1
1: 1
2: 13
3: 24
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944763445 Original CRISPR CAGCTCGGAGAGCTTGGCAT TGG Intronic
900121275 1:1049633-1049655 CAGCGCCTGGAGCTTGGCATTGG + Exonic
904296212 1:29521343-29521365 CAGCTCCCAGGGCTTGGCACAGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
911847419 1:102771975-102771997 CAGCTCTGAGAGTTCTGCATTGG - Intergenic
912219863 1:107661200-107661222 CAGCTAGCAGATCCTGGCATGGG - Intronic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
1066071491 10:31819220-31819242 TGGCACGGAGAGATTGGCATGGG + Intronic
1070922733 10:80198384-80198406 CAGCTAGGAGGGCCTGCCATGGG + Intronic
1071671826 10:87616189-87616211 TAACACTGAGAGCTTGGCATGGG - Intergenic
1074637084 10:115331985-115332007 CAGCACAGAGAACTTGGCAGTGG - Intronic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1084507259 11:69576035-69576057 CATCCAGGAGAGCTTGGCCTGGG - Intergenic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089535138 11:119156421-119156443 CATCTCAAAGAGCTTGGCACTGG - Exonic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1090920674 11:131203624-131203646 CAGCTCTGAGAAGTTGCCATGGG - Intergenic
1092719600 12:11428478-11428500 CAGAGCTGAGAGCTTTGCATGGG - Intronic
1096609452 12:52791340-52791362 CAGCTCTTGGAGCTTGGCATTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097303524 12:58043597-58043619 GAGCCCAGAGAGTTTGGCATAGG - Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100616998 12:96238502-96238524 CAGCCGGGGGAGCTTGGCAGTGG + Intronic
1102749759 12:115282260-115282282 CAGCTCTGAGAGCAAGGCCTGGG + Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1114083399 14:19220120-19220142 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1114265974 14:21072811-21072833 CCGCTCTGAGACCTTGGCTTTGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119703571 14:76770700-76770722 GAGATGGGAGAGCTAGGCATGGG + Intronic
1119756160 14:77121187-77121209 CAGATGGGAGCGCTTGGCATGGG + Intronic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1120860710 14:89252980-89253002 AAGCTCCGAGAGCTTGGAAGGGG + Intronic
1202895013 14_GL000194v1_random:1889-1911 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1124874626 15:33580410-33580432 CAGCTGTGAGAGCATGACATTGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128306230 15:66600641-66600663 CACCTCGGAGAGCTGTGAATGGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1133219762 16:4315175-4315197 AAGCTCGGATTGCTCGGCATCGG + Exonic
1133988256 16:10684780-10684802 CAGCAGGGTGAGCTTGGCATTGG - Intronic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1135239780 16:20793971-20793993 CAGCTCCGGGGGCTTGGCATAGG + Intronic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139393169 16:66618896-66618918 CAGCTCTGAGCGCTTGGCCCTGG - Intronic
1139736223 16:68991186-68991208 CAGCTCTGAGAGCTGAGCAGAGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1140808360 16:78553853-78553875 CTGCCCGGAGAGCTTGGCTGAGG + Intronic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1144826551 17:18108584-18108606 CAGCCTGGAGAGCTGAGCATGGG - Intergenic
1148241667 17:46003176-46003198 CAGATCGGAGAGATGGGCAGAGG - Intronic
1148791474 17:50175618-50175640 CAACTGCGAGTGCTTGGCATTGG - Intronic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1154500082 18:14991783-14991805 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1156263548 18:35466721-35466743 CAGCAGGGAGAGCCTGGCAGGGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157427226 18:47594317-47594339 CTGCTTTGAGGGCTTGGCATAGG - Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1160826557 19:1082950-1082972 CGGCTCGGAGAGCGAGGCAGTGG + Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161430822 19:4231321-4231343 CAGGTCGGAGAGCCTGGAAGGGG + Exonic
1164931487 19:32179281-32179303 TAGTCCGCAGAGCTTGGCATGGG + Intergenic
1167528552 19:50000687-50000709 CAGCTGGGAGAGCTCGGCCGGGG - Intronic
925974336 2:9130691-9130713 CAGAGAGGAGAGCCTGGCATCGG - Intergenic
926140768 2:10366629-10366651 CAGCACTGTGAGCTTGGTATGGG - Intronic
926332021 2:11833393-11833415 AAGCACAGAGAGCTTGGTATGGG - Intergenic
927007028 2:18861531-18861553 CAGCCTAGAGGGCTTGGCATGGG - Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928730352 2:34224740-34224762 GAGCTCGGAGAGTTTGGAGTAGG + Intergenic
929888659 2:45901327-45901349 CAGGTCGGAGCGTTTGGCCTTGG - Intronic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
932134347 2:69215157-69215179 CTACTTGGAGAGCTTGGAATGGG - Intronic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
934926798 2:98387852-98387874 CAGAACGGAGAGCCTGGCGTGGG + Intronic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
935183024 2:100706925-100706947 CAGCTCCGAGCGCTGGGCAGGGG + Intergenic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
936892951 2:117393348-117393370 CACCTCTGAAAGCTAGGCATGGG + Intergenic
938259286 2:129883677-129883699 CTGTTTGGAGAGCTGGGCATGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943858464 2:192828662-192828684 CAGCTCAGAGAGATCGGCAGCGG - Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948140820 2:235670627-235670649 CAGCTCCGGGAGCCTGGCCTGGG + Intronic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1174043724 20:47718147-47718169 CAGGTCTGAGGGCTGGGCATGGG + Intronic
1175788397 20:61726097-61726119 CAGTGGGGAGAGCATGGCATGGG + Intronic
1175948701 20:62570920-62570942 CAGCTGTAAGTGCTTGGCATTGG - Intergenic
1176614716 21:9017876-9017898 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1176710495 21:10145995-10146017 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1179572252 21:42284652-42284674 CAGCTCGAAGAGTTTGGCGCTGG - Exonic
1180294576 22:10873147-10873169 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1180497382 22:15902561-15902583 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1181763123 22:25071728-25071750 CAGAACTTAGAGCTTGGCATAGG + Intronic
950242948 3:11388076-11388098 CATCTAGGAGAGCTTGGGAATGG - Intronic
950704044 3:14769219-14769241 GAGCTCAGAGGGCTTGGCAGAGG + Intronic
950759049 3:15204205-15204227 CAGCTCTGAGTGCTTAACATTGG + Intergenic
950882483 3:16334551-16334573 CAGCTCAGAGAACTGGGCAATGG + Intronic
952039320 3:29242454-29242476 CAGAACGGAAAGCTTGACATGGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953192578 3:40701472-40701494 CTGCTTGGTGAGCTTGGCTTTGG + Intergenic
953414850 3:42709719-42709741 CACATCGGAGAGCTGGGCAAAGG + Exonic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
961499796 3:127324081-127324103 GAGCTCGGTGAGTTTGGCAGAGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
968313580 3:197703930-197703952 CAGCCCCGAGAGTTGGGCATTGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
972492399 4:39600203-39600225 CACATTGGAGAGCCTGGCATGGG - Intronic
976612857 4:87047548-87047570 CAGTTTGGTGAGCTTGGCTTTGG - Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978101700 4:104849347-104849369 CAGCTTGGAGGGCTTCCCATTGG - Intergenic
978853271 4:113363859-113363881 CAGCTCAGAGCACTTTGCATGGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991468747 5:66944768-66944790 CAGCCAGGAGAGCTTGGAAGAGG - Intronic
992746709 5:79827654-79827676 CAGCACGGTGAGCTCTGCATGGG - Intergenic
993438464 5:87925897-87925919 GAGCCCAGAGAGTTTGGCATGGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
998183556 5:139962001-139962023 CAGCACAGAGAGCTGGTCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999280785 5:150364197-150364219 CACCTCGGAGAGCTCGGAAGAGG + Exonic
1003053931 6:2802640-2802662 CAGCTCAGAGAGCCTGACAAAGG + Intergenic
1003924517 6:10864339-10864361 CAGCTGGAAGAGCTGGGCAGAGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018756312 6:166852672-166852694 CAACTCCGGGAGCTGGGCATTGG + Intronic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1022666648 7:32416993-32417015 CGGCTGGGAGAGCCAGGCATGGG - Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1025160784 7:56658921-56658943 CACCTCTGAGAGATTGGCCTGGG - Intergenic
1028666970 7:93356694-93356716 CAACTCAGTGAGCTTGGTATGGG + Intronic
1029217573 7:98962401-98962423 GAGCTGGGAGGGATTGGCATTGG - Exonic
1033728430 7:144147188-144147210 CTGCTGGGATAGCCTGGCATTGG - Intergenic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1039228981 8:35422128-35422150 CAGCTCGGAGAGTGTGAGATGGG - Intronic
1041472404 8:58225365-58225387 CAGCCCTGAGACCTTGGCAGTGG - Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1044731108 8:95229340-95229362 GAGCTCGGAGAGCAGGGAATGGG - Intergenic
1047466009 8:125115063-125115085 CAACTCTCAGAGCTTGGCAGTGG + Intronic
1049798343 8:144506532-144506554 CTGCTCGGTGAGCTTGGCCTTGG - Exonic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1053231281 9:36412172-36412194 GAGCTTGGAGAGGTGGGCATGGG - Intronic
1053647473 9:40131693-40131715 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1053758255 9:41332150-41332172 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1054328455 9:63729647-63729669 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1054537106 9:66244477-66244499 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1056966396 9:91166172-91166194 CAGATAGGAGACCTTGACATTGG - Intergenic
1057812932 9:98271614-98271636 CAGCTCCTTGAGCTTGCCATTGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059418679 9:114177727-114177749 CAGCACACAGAGCATGGCATGGG - Intronic
1060184759 9:121557619-121557641 CAGCCCCCAGAGCTTGGCCTTGG - Intergenic
1202795258 9_KI270719v1_random:114990-115012 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1188612492 X:32117571-32117593 CAGCTCGAAGAGGTTGGAAGGGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1194356885 X:92896336-92896358 CAGCCCAGAGGGTTTGGCATGGG - Intergenic
1194585259 X:95725201-95725223 CAGTTCTGAGTGCTTTGCATGGG + Intergenic
1198579584 X:138048946-138048968 GAGCTCAGAGGGTTTGGCATGGG + Intergenic
1200665218 Y:6013330-6013352 CAGCCCAGAGGGTTTGGCATGGG - Intergenic