ID: 944783090

View in Genome Browser
Species Human (GRCh38)
Location 2:203040091-203040113
Sequence TGCCATCTTTCTAGTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944783090_944783091 5 Left 944783090 2:203040091-203040113 CCTTCAACACTAGAAAGATGGCA 0: 1
1: 0
2: 0
3: 17
4: 218
Right 944783091 2:203040119-203040141 AGAGCAAAGAAAAATCCATTTGG 0: 1
1: 10
2: 13
3: 61
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944783090 Original CRISPR TGCCATCTTTCTAGTGTTGA AGG (reversed) Intronic