ID: 944783090 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:203040091-203040113 |
| Sequence | TGCCATCTTTCTAGTGTTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 236 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 17, 4: 218} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 944783090_944783091 | 5 | Left | 944783090 | 2:203040091-203040113 | CCTTCAACACTAGAAAGATGGCA | 0: 1 1: 0 2: 0 3: 17 4: 218 |
||
| Right | 944783091 | 2:203040119-203040141 | AGAGCAAAGAAAAATCCATTTGG | 0: 1 1: 10 2: 13 3: 61 4: 584 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 944783090 | Original CRISPR | TGCCATCTTTCTAGTGTTGA AGG (reversed) | Intronic | ||