ID: 944796027

View in Genome Browser
Species Human (GRCh38)
Location 2:203186301-203186323
Sequence TACTCAGATGTGGCTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944796024_944796027 28 Left 944796024 2:203186250-203186272 CCTAAAATTCAGTATCTCATTAT 0: 1
1: 0
2: 5
3: 37
4: 585
Right 944796027 2:203186301-203186323 TACTCAGATGTGGCTCCTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944796027 Original CRISPR TACTCAGATGTGGCTCCTCT TGG Intronic
900922924 1:5685113-5685135 TGCTCAGAGCTGGCTGCTCTGGG + Intergenic
903140762 1:21337912-21337934 TGCTCAGATGTGGCACCTGGAGG + Intronic
903772798 1:25774530-25774552 TGCTCAGATGGGGCTCCTGCAGG + Intronic
904345801 1:29868290-29868312 TCCTCAGATGCAGTTCCTCTGGG + Intergenic
904953828 1:34266560-34266582 CACTCAGATGGGGCTCGGCTCGG + Intergenic
905976672 1:42180334-42180356 TACTCAGCTGTGGTTCCTTCTGG - Intronic
907831826 1:58071462-58071484 GACTGTGCTGTGGCTCCTCTAGG + Intronic
908661166 1:66436868-66436890 GACTCTGATGAGGCTTCTCTTGG - Intergenic
908738514 1:67302716-67302738 TAGTGAGATATGCCTCCTCTGGG - Intergenic
909239212 1:73191219-73191241 GTCTCAGATATGGCTCCTATAGG + Intergenic
912892853 1:113553578-113553600 TAGTCAGATAAAGCTCCTCTAGG + Intronic
913238877 1:116810579-116810601 TACACTGATGTGGTTTCTCTTGG + Intergenic
918171215 1:181999104-181999126 TTCTCAGCTGTGCCTCCACTAGG - Intergenic
918479179 1:184959175-184959197 TGCTGAGATGTGGCTGGTCTGGG - Intronic
918516572 1:185369983-185370005 GACTCAAATTTGGCTTCTCTTGG + Intergenic
919657832 1:200214568-200214590 AAAGCAGATGTGGCTCCTTTGGG - Intergenic
920709501 1:208281543-208281565 GATTCAGTGGTGGCTCCTCTGGG + Intergenic
922058118 1:222061374-222061396 CACTCAGATGTGGTTCTTGTTGG + Intergenic
1065750619 10:28883351-28883373 TTCCCAGATTTGTCTCCTCTGGG + Intergenic
1067993320 10:51240708-51240730 TACACAGAGGAGGCCCCTCTTGG - Intronic
1070458868 10:76644806-76644828 TCCTCAGATGTGAATCTTCTTGG - Intergenic
1071438469 10:85668470-85668492 ATCTCAGAAGTGGCTTCTCTTGG - Intronic
1075226990 10:120638660-120638682 TATTGAGATGTTGCACCTCTAGG - Intergenic
1075232811 10:120698116-120698138 TACTCAGATTTTGCTTGTCTGGG + Intergenic
1076057958 10:127390884-127390906 TTCACGGATGTGGCTCCTATTGG + Intronic
1080678311 11:34448470-34448492 CACTCAGCTGTCCCTCCTCTAGG - Intronic
1084075863 11:66775637-66775659 TGCTTAGATGTGGCTCTTGTTGG + Intronic
1084103647 11:66966461-66966483 TCCTCAGAATTTGCTCCTCTCGG + Intergenic
1085849054 11:80098741-80098763 AACTCAGATGTGTCCTCTCTCGG + Intergenic
1088599618 11:111462911-111462933 TCATCAGATGTGGCTCTTCAGGG + Intergenic
1089182815 11:116594728-116594750 TGCTCAAATGTCCCTCCTCTGGG + Intergenic
1093881932 12:24414606-24414628 TCATCACATGTGGCACCTCTGGG - Intergenic
1101055212 12:100905413-100905435 TTCTGAGATGTGGCACTTCTGGG - Intronic
1104036065 12:125097763-125097785 TACTGAGATGGGGCTCCCCCTGG - Intronic
1104112023 12:125713093-125713115 GACTCAGCTGTGGATCCTTTGGG + Intergenic
1106009422 13:25804684-25804706 TACTCTGAAGGGGCTCCTCCAGG + Intronic
1107385496 13:39904199-39904221 TACTCAGATGTGTCTTCTCAGGG - Intergenic
1109269966 13:60244556-60244578 TACTCATATATGGAACCTCTGGG + Intergenic
1111878517 13:93925898-93925920 TACTCACATGTTTGTCCTCTCGG + Intronic
1113852238 13:113424382-113424404 TACCCAGAAGTGGCTCCACTTGG - Intronic
1116802089 14:49453701-49453723 TGCTCTGATGTGGCCACTCTTGG - Intergenic
1116996908 14:51334090-51334112 TACACAGATATGGCTTCTCATGG - Intergenic
1121916482 14:97840531-97840553 CATTCCGGTGTGGCTCCTCTAGG - Intergenic
1121946778 14:98130748-98130770 TACACAGATGTGGCATCTCAGGG + Intergenic
1123840161 15:24240080-24240102 TACTGAGATGTGGTTGCACTAGG + Intergenic
1123853103 15:24380597-24380619 TACTGAGATGTGGTTGCACTAGG + Intergenic
1123869064 15:24553165-24553187 TACTGAGATGTGGTTGCACTAGG + Intergenic
1129688360 15:77699000-77699022 TCCTCAGAGGTGGCTCCTAAGGG + Intronic
1130134230 15:81168564-81168586 GAGTCAGATGTGGCTCCTCATGG - Intronic
1130433629 15:83874331-83874353 CACTCTCATGTGGCTTCTCTGGG - Intronic
1131880812 15:96860129-96860151 TTCTCAGGATTGGCTCCTCTTGG + Intergenic
1132463515 16:67118-67140 GACTCAGAGGTGGCCCCTCCTGG - Intronic
1133796458 16:9050423-9050445 TGCGCAAATGGGGCTCCTCTGGG + Intergenic
1135423850 16:22322696-22322718 TTCACAGATGTGGCTCCTAAGGG + Intronic
1135544759 16:23358175-23358197 GACTCAAATGGGGCTCCTTTTGG - Intronic
1136170676 16:28487402-28487424 TGCTCTGATGTGGTTCCTCGGGG + Intronic
1140320814 16:73950324-73950346 TTCTAAGATGTGGATCATCTAGG - Intergenic
1140910254 16:79444878-79444900 TCCTCATATGTTGATCCTCTTGG - Intergenic
1141266244 16:82500137-82500159 GACTCACATCTGGCTCCACTGGG + Intergenic
1141995498 16:87634422-87634444 AACTCAGAAGTGGCTCCTGTGGG - Intronic
1143082807 17:4394184-4394206 TCCTCAGAGGTGGCCCCACTGGG + Intergenic
1143535917 17:7539392-7539414 TTCTCAGAAGTGACCCCTCTGGG - Intergenic
1145414261 17:22702434-22702456 TACTCTTATGTAGCTACTCTTGG - Intergenic
1148968093 17:51454934-51454956 TCCTGTGCTGTGGCTCCTCTTGG + Intergenic
1152364682 17:79848772-79848794 AAGGCAGATGTGGCTCCCCTGGG - Intergenic
1153109037 18:1561584-1561606 TACTCAGAAGTGGGTCTTTTGGG + Intergenic
1153657487 18:7296780-7296802 TATTCAGATGTGTTTCTTCTTGG + Intergenic
1160512268 18:79459238-79459260 CACGCAGACGTGGCTCCCCTTGG + Intronic
1166040515 19:40199683-40199705 TATTCAGACATGGCTCCTCATGG - Intronic
1166177168 19:41082324-41082346 CACTCAGCTGAGGCTGCTCTAGG + Intergenic
1166573462 19:43814569-43814591 TACTCAGAGGTGGGTCCTACAGG - Intronic
1167291010 19:48625120-48625142 CGCTCGCATGTGGCTCCTCTCGG + Intronic
1168358107 19:55714882-55714904 TACTAGGAGGTGGATCCTCTGGG - Intronic
925594605 2:5543034-5543056 TACTTGGATGTGGTTCCTTTGGG + Intergenic
928654855 2:33439948-33439970 TTCTCAGATGTGTCTCCATTGGG - Intronic
929783835 2:44975045-44975067 TACTAAGAAGTGGGGCCTCTGGG + Intergenic
931619651 2:64197133-64197155 TATTCAGCTGTGGTTGCTCTCGG + Intergenic
931830211 2:66043216-66043238 TATTCAGATGTGGGGCCTTTAGG - Intergenic
935140405 2:100348348-100348370 TTCTAAGATGTGGCCCATCTGGG + Intergenic
937452132 2:122010507-122010529 TCCACAGATGTGGCTTCCCTGGG - Intergenic
938370866 2:130767639-130767661 GGCTCAGATGTGGCTCCACAGGG - Exonic
938692051 2:133800634-133800656 TCCCCAGCTGTGGCCCCTCTTGG - Intergenic
939883588 2:147657247-147657269 GAGCCAGATGTGGCTGCTCTTGG - Intergenic
940836820 2:158531057-158531079 TACTCAGAAAGTGCTCCTCTGGG + Intronic
941054769 2:160774689-160774711 TATTAAGATGTGGATCCTATAGG - Intergenic
942141684 2:172983804-172983826 TACTCACATGGGGCTGCTCTGGG - Intronic
942928810 2:181464571-181464593 TACTCAGATTTCACTCCTCCAGG - Intronic
944120425 2:196234747-196234769 TACTAAGAAGTTGCTTCTCTAGG - Intronic
944796027 2:203186301-203186323 TACTCAGATGTGGCTCCTCTTGG + Intronic
948687603 2:239678860-239678882 TCCTCGCATGTGGCTACTCTAGG + Intergenic
948771667 2:240254460-240254482 CTCTCAGATGTCGCTCCTCCTGG - Intergenic
1168986296 20:2051799-2051821 TACCCAGATTTGGATACTCTAGG - Intergenic
1169270400 20:4194912-4194934 TACTCAGATGTCACTTCTTTGGG + Intergenic
1169639863 20:7739698-7739720 TACTAAGAGGTGGCACCTGTAGG - Intergenic
1172949177 20:38711442-38711464 GCATCAGATGTGGCTTCTCTGGG + Intergenic
1173337428 20:42124165-42124187 TGCTCAATTGGGGCTCCTCTGGG + Intronic
1174622254 20:51884764-51884786 TAATCAGTTGTGACTCATCTTGG - Intergenic
1178812087 21:35893644-35893666 TACACAGCTGTGGCTCCTAAGGG + Intronic
1180026028 21:45162599-45162621 TAGTCAGGTGTGGCTCTTTTTGG - Intronic
1180232280 21:46434370-46434392 GGCTCAGCTGTGGGTCCTCTGGG + Intronic
1181636157 22:24175832-24175854 GACTCAGGTGTGGCCCCACTGGG + Intronic
1182312143 22:29416833-29416855 TTCTCAGACCTGGCTCCTCCAGG - Intronic
1182742604 22:32579516-32579538 TATTAAGAGGTGGTTCCTCTGGG - Intronic
1183588811 22:38768265-38768287 TGCTCTGAGGTGGCTGCTCTAGG + Intronic
1184516394 22:44965320-44965342 CCCTCAGATGTGGGTCCTTTGGG + Intronic
949164032 3:915384-915406 TACTCAGATGTTCCTCTTCTTGG - Intergenic
952002263 3:28799695-28799717 TATTCTGATGTGGGTCCTATTGG + Intergenic
953173594 3:40529424-40529446 TATGCAAATGTGGCTTCTCTGGG + Exonic
953957597 3:47243774-47243796 TCCTCAGATCTGCCTCTTCTCGG - Intronic
955251431 3:57286847-57286869 TATTCACATGTTGCTACTCTTGG + Intronic
962939726 3:140114880-140114902 TTCTCTGATGTGGCTTTTCTAGG + Intronic
963931740 3:151010489-151010511 TGCTGAGATGTGGCACCTCATGG + Intergenic
965685634 3:171299242-171299264 AATTTAGAGGTGGCTCCTCTAGG + Intronic
970714369 4:18904603-18904625 TACCCAGATGTGGCTACCATAGG + Intergenic
970714855 4:18909039-18909061 AACTGAGATGTGTCTCTTCTAGG - Intergenic
971835251 4:31754948-31754970 TACACAGATGTGGCTCCTAATGG - Intergenic
973922705 4:55704904-55704926 TTCTTGGATGTGGCTCCCCTTGG + Intergenic
978196538 4:105978916-105978938 TACTCAGGTCTGGCTTTTCTGGG - Intronic
981002750 4:139843322-139843344 TACTAAGATGTGTCTACTCTCGG + Intronic
982380252 4:154742029-154742051 CACTCTGAACTGGCTCCTCTGGG - Intronic
983776588 4:171615571-171615593 TAGGCACATGGGGCTCCTCTTGG - Intergenic
987479739 5:18438502-18438524 GACTCAGGTGTTGTTCCTCTAGG - Intergenic
989257497 5:39381252-39381274 AACTCACATTTGGCTCCTCGAGG - Intronic
991926156 5:71706943-71706965 TTCACAGCTGTGGCTCCTCAGGG + Intergenic
993790421 5:92201494-92201516 TATTCAGATTTGGGACCTCTTGG + Intergenic
997441765 5:133913513-133913535 TACTCTGAGGTAGCTGCTCTAGG - Intergenic
997544830 5:134697225-134697247 TATTCTGATTTGGCTTCTCTGGG + Exonic
997667416 5:135642829-135642851 GACTCAAATGTGGCTCCTGATGG + Intergenic
998793934 5:145797314-145797336 TGCTTTGATGTGGCTCTTCTTGG - Intronic
999226539 5:150029834-150029856 CACACAGATGTGGCAGCTCTGGG + Intronic
1002566661 5:180116016-180116038 CACACAGAGGAGGCTCCTCTGGG + Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007387252 6:41528303-41528325 TCCTCAGATCTGCCTCCTCCGGG + Intergenic
1012160047 6:95873309-95873331 TATTTGGATGTGGGTCCTCTGGG + Intergenic
1015926976 6:138320469-138320491 TTCACACATGTGGCTCCACTGGG - Intronic
1019263255 7:94356-94378 TGCTCAGATGTGGCCCTTCTGGG - Intergenic
1021063960 7:16149266-16149288 TAAACAGTTTTGGCTCCTCTTGG + Intronic
1022269314 7:28790689-28790711 TAGGCAGATGTTGCTACTCTGGG - Intronic
1025105566 7:56169323-56169345 TTCTCTGATGGGGCTTCTCTGGG - Intergenic
1026314656 7:69217841-69217863 TTCTCTGATGGGGCTTCTCTGGG - Intergenic
1026474428 7:70722342-70722364 TACTTAGATGTAGCTGCTTTGGG + Intronic
1029032435 7:97482956-97482978 TACTGAGATGTGGGTTCTCAAGG + Intergenic
1029883372 7:103840274-103840296 TAGTCAGAAATGGCTCCTATCGG + Intronic
1030786956 7:113674280-113674302 TACTAAGATGTGGGGCCTTTAGG + Intergenic
1030867871 7:114721645-114721667 TATTCAGAGGTGTGTCCTCTGGG + Intergenic
1032615167 7:133460985-133461007 TAATCATCTGTGGGTCCTCTAGG + Intronic
1036136936 8:6170790-6170812 TAGTGAGATATGTCTCCTCTGGG + Intergenic
1036964745 8:13284145-13284167 TACTGAGATTTGACTCTTCTGGG - Intronic
1038981908 8:32768883-32768905 TACCTAGTTATGGCTCCTCTAGG + Intergenic
1039111966 8:34050843-34050865 TAGTCAGAAATGGCTTCTCTGGG - Intergenic
1041527792 8:58827213-58827235 TACTCACATGTGGTTTCCCTGGG - Intronic
1042192293 8:66199318-66199340 TGATCAGATGTGGGGCCTCTTGG - Intergenic
1043689543 8:83132928-83132950 TCCTCTGATGTTGCTCCTCAAGG - Intergenic
1044448086 8:92301842-92301864 TACTAAGATGTTGCTCCTTGGGG - Intergenic
1046790362 8:118315589-118315611 TACTCATATGTGGTTCCTTGAGG + Intronic
1049234840 8:141507366-141507388 TGCTCAGACGTGGGTCCTCAAGG + Intergenic
1049243159 8:141548896-141548918 TCCTCAGAGGTGGCCCCTCAGGG + Intergenic
1059995621 9:119905687-119905709 GGCTCAGAAGTGGCTGCTCTTGG + Intergenic
1061207106 9:129171160-129171182 ATCTCACATGTGGCTCCTCAAGG - Intergenic
1186977522 X:14924127-14924149 TACTCAAATGTGGCAGCTCTGGG - Intergenic
1187725382 X:22197011-22197033 TACTCACCTGTGGCTTCTCTTGG + Intronic
1190382895 X:49856591-49856613 TTCTCAGAACTGGCTCTTCTTGG - Intergenic
1197170442 X:123427889-123427911 AACTTAGATCTGGCCCCTCTGGG + Intronic
1197665980 X:129223994-129224016 TACTCACATGTCACTCATCTAGG + Intergenic
1198012311 X:132570338-132570360 TATGCAGATGTGTCTCCTCAAGG + Intergenic
1199830087 X:151540485-151540507 TACTCAGTGGTGGCTTCTGTGGG - Intergenic
1201522890 Y:14896226-14896248 AACCCAGATGTGACTTCTCTTGG + Intergenic
1201862287 Y:18612053-18612075 TACACAGATTTGCTTCCTCTGGG - Intergenic
1201863179 Y:18621877-18621899 TACACAGATTTGCTTCCTCTGGG - Intergenic
1201870143 Y:18698501-18698523 TACACAGATTTGCTTCCTCTGGG + Intergenic
1201871036 Y:18708327-18708349 TACACAGATTTGCTTCCTCTGGG + Intergenic
1202259322 Y:22953626-22953648 TACTCACATATGGCTGCACTAGG + Intergenic
1202412308 Y:24587370-24587392 TACTCACATATGGCTGCACTAGG + Intergenic
1202458472 Y:25082700-25082722 TACTCACATATGGCTGCACTAGG - Intergenic