ID: 944796892

View in Genome Browser
Species Human (GRCh38)
Location 2:203196216-203196238
Sequence CTGCACCTGCAGATGGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944796892 Original CRISPR CTGCACCTGCAGATGGAACT TGG (reversed) Intronic
900115837 1:1027555-1027577 CAGCACCTGCAGAAGGTCCTGGG - Intronic
900570279 1:3354925-3354947 CTGCACCTGCTGAAGGGAGTGGG + Intronic
900922881 1:5684774-5684796 CTGCACCTGAACATGGAACATGG - Intergenic
901041775 1:6368450-6368472 CTGCACCTGCATATGGAGTGTGG - Intronic
901162757 1:7192598-7192620 CTGCTCCTGCAGGTGGCACTCGG - Intronic
901251894 1:7784963-7784985 TTTCCTCTGCAGATGGAACTCGG - Exonic
901913104 1:12476966-12476988 TTTCACCTGCAGATAGAACTAGG + Intronic
904411178 1:30325776-30325798 CTGCGTCTGCTGATGGGACTTGG + Intergenic
905324403 1:37140576-37140598 CTGAACCTGCAGGAAGAACTTGG + Intergenic
905506023 1:38480385-38480407 CTGGGCCTCCAGAAGGAACTGGG + Intergenic
905816167 1:40952690-40952712 CTGCACCTGGAGCTGAAATTAGG + Intergenic
905998273 1:42401138-42401160 CTGCACATGCAGGGGGATCTAGG - Intronic
906287041 1:44594328-44594350 CTTCACCTGCACTTGGGACTGGG + Intronic
907697964 1:56753115-56753137 CTACTTCTGCAGATGGGACTGGG + Intronic
908219108 1:61985671-61985693 CTGCACCTGCAGATGTTCCAGGG + Intronic
911748200 1:101464513-101464535 TTGCACCTGCAGATGCAACATGG + Intergenic
914391523 1:147227746-147227768 ATGCACATGCATGTGGAACTGGG + Intronic
917056697 1:170990052-170990074 CTGCACTGTCAGATGGACCTGGG + Intronic
920337455 1:205254716-205254738 CTGCACCACCAGAATGAACTGGG - Intronic
922406685 1:225321601-225321623 GTGCACCAGCATTTGGAACTTGG - Intronic
922841971 1:228650169-228650191 CTGCAGCCGCTGATGGAACTAGG - Intergenic
923000388 1:230002269-230002291 CTGCACCTGCAGGGGGGCCTGGG - Intergenic
923512102 1:234661561-234661583 CTGCACATGCACTTGGACCTAGG - Intergenic
923688244 1:236169161-236169183 CTGCACCTGCAGTGGGAGCATGG - Intronic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1065160473 10:22915830-22915852 CTGCAATTACACATGGAACTTGG + Intergenic
1067539556 10:47141871-47141893 CTGCACCTGCTCATGGATGTTGG - Intergenic
1067689745 10:48494110-48494132 CGGCACCTGCACGTGGTACTTGG + Intronic
1069723684 10:70564556-70564578 TGGCTCCTGCAGATGGAGCTGGG + Intronic
1069855680 10:71439727-71439749 CTGCAGCTCCAGAGAGAACTGGG - Intronic
1075837672 10:125469573-125469595 CTCCACCTGCACATGGCACATGG + Intergenic
1076196521 10:128522479-128522501 TTGCAGCTGCAGACGCAACTTGG - Intergenic
1076239874 10:128896512-128896534 CTCCATCTGCAAATGAAACTAGG + Intergenic
1076387050 10:130064862-130064884 CTTCACCCGCAGAAGTAACTGGG + Intergenic
1076992134 11:280926-280948 CTGCGCCAGCAGCTGGAGCTCGG + Exonic
1077056308 11:595513-595535 CTCCACCTGCACAGGGAGCTTGG - Intronic
1077508029 11:2941126-2941148 CTGCTCCAGCAGAAGGAACCTGG + Intergenic
1078936866 11:15959229-15959251 CTCCACCTGCAGAGGTAACTGGG - Intergenic
1080852069 11:36078624-36078646 CTGCATCTGCAGCTGCAATTTGG + Intronic
1081626397 11:44658555-44658577 CTGGGTCTGCAGGTGGAACTGGG - Intergenic
1084660666 11:70544631-70544653 CTGGACCAGCAGATGGACTTGGG + Intronic
1087604099 11:100354109-100354131 CTCCTCTTGCAGGTGGAACTGGG - Intronic
1088869628 11:113879692-113879714 GTGCACCTGCAGATTCAACTTGG + Intergenic
1091006382 11:131957402-131957424 CTGCACCTGCAGGAGGGAGTTGG - Intronic
1092622603 12:10289024-10289046 CAGTATCTGCCGATGGAACTTGG - Intergenic
1092891706 12:12975206-12975228 TTGGACTTGCAGCTGGAACTTGG + Exonic
1096096905 12:48941440-48941462 CTGCACCTGTAAATGGAAGGGGG + Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1098337206 12:69416370-69416392 CTGCAACTACATACGGAACTGGG + Intergenic
1098951487 12:76644915-76644937 CTGCAGCTGCAGCTGCACCTGGG - Intergenic
1099960970 12:89396619-89396641 CTGCAGCTGAAAATGGAAATGGG + Intergenic
1101000599 12:100353821-100353843 CTGAGCCTGCAGATGGGAGTGGG - Intergenic
1101599097 12:106193151-106193173 CTGCACCTCCAGATACAGCTAGG + Intergenic
1102189670 12:110977652-110977674 CTGCAACGGCAGAAGGAAATGGG + Intergenic
1102779125 12:115548277-115548299 CTGAACCTGCAAATAGAAGTCGG - Intergenic
1103455294 12:121060480-121060502 CTGCTCCTGCAGCAGGAAATAGG - Intergenic
1108492319 13:50993900-50993922 CTGCACCTACAGCTGGAAGCAGG + Intergenic
1113002727 13:105661201-105661223 CTCGACCTGCAAATAGAACTTGG + Intergenic
1113404366 13:110024241-110024263 CTGCCCCTGCAGAAGGCCCTGGG + Intergenic
1114391101 14:22309502-22309524 CTGCTCCTGCTGATGGAAGAGGG + Intergenic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1117334906 14:54748902-54748924 CTGCGCCTCCAGCTGGCACTCGG - Exonic
1118501303 14:66364997-66365019 GTGCACCAGCAGATGGGACATGG - Intergenic
1119627532 14:76192588-76192610 GTGCAGCTGCAGATAGGACTTGG + Intronic
1120999344 14:90440311-90440333 CTGCATCTGCTGAGGGAACGAGG + Intergenic
1122606365 14:102949274-102949296 CTGCTCCTGCAGCTGACACTGGG + Intronic
1127360474 15:58240757-58240779 CTCCTCCTGAAGATGGATCTGGG + Intronic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1129454431 15:75669197-75669219 CTGCACCTGGACAAGCAACTGGG - Intergenic
1129707435 15:77802784-77802806 TGGCAGCTGCAGATGGAACATGG - Intronic
1130042087 15:80413602-80413624 GAGCAGCTGCAGGTGGAACTAGG + Intronic
1132029157 15:98426568-98426590 CTGCACCTGCATCTGGTCCTTGG + Intergenic
1133216738 16:4297177-4297199 CTGTACCTGCAGCTGCATCTGGG - Intergenic
1136016295 16:27403233-27403255 CTCCACATGCACAGGGAACTGGG - Intronic
1138433400 16:56983598-56983620 CTGCTGCTGCAGATGGACTTTGG + Exonic
1138671075 16:58615070-58615092 CTGAACCTGCAGGTGGACTTGGG + Intronic
1140300522 16:73752906-73752928 CTGTACCTGCAAATGGTACCTGG - Intergenic
1141702081 16:85647142-85647164 CCGCACCTGCAGATGGGCCGGGG + Intronic
1141704541 16:85657511-85657533 CAGCACCTGCTGCCGGAACTCGG - Exonic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1143280775 17:5752622-5752644 GGGCCCCTGCAGATGGATCTAGG - Intergenic
1143496020 17:7313041-7313063 CTGCATCTGCACAGGGAGCTGGG + Exonic
1144338659 17:14295684-14295706 CTGCACCTGTAGAAGGAAGGAGG + Intergenic
1145015221 17:19392151-19392173 CTGCACCTGCAGAGAGAATAGGG - Intergenic
1148865016 17:50623890-50623912 CTGCATCTGCAAAAGGAACAGGG - Exonic
1149088597 17:52751095-52751117 CTGCAGCTGCAGCTGCATCTGGG - Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150621306 17:66809664-66809686 CTGCAAGTTCAGGTGGAACTTGG + Exonic
1151656786 17:75499865-75499887 CTGAACCTGAAGATGGAGCAGGG + Exonic
1157923572 18:51738990-51739012 ATGCATCTGTTGATGGAACTTGG - Intergenic
1158396348 18:57081121-57081143 CTGCACCTGCAGAGGAAAGGGGG + Intergenic
1160354542 18:78215988-78216010 CTGCACCTGGAGAGTGAACATGG - Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1160710659 19:549577-549599 CTGCACCTGCTGAGGGGACGAGG - Intronic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1161007826 19:1945193-1945215 CTGCACCTGCAGAGGGGCCCTGG - Intronic
1161894417 19:7069583-7069605 CTGCACCTGCAGCCTGAACCCGG + Exonic
1162490625 19:10989246-10989268 CTGCAGCTCCAGCTGTAACTGGG + Intronic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1163324121 19:16592263-16592285 CCCCTCCTGCAGATGGAACTTGG - Intronic
1163546327 19:17943270-17943292 CGGCACCTCCAGATGGCTCTTGG - Exonic
1163589545 19:18184461-18184483 CTGCCTCTGCAGATGCAAATTGG - Intergenic
1164506153 19:28863181-28863203 ATGCACCTGCAGAATGACCTTGG + Intergenic
1165061541 19:33207394-33207416 CAGCTCCTGCAGATGCACCTCGG + Exonic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1167517330 19:49930786-49930808 CTGCACCAGCAGCTGGCACGAGG - Exonic
925737256 2:6974340-6974362 CGGCAACGGCAGATGGATCTCGG - Intronic
925912942 2:8584863-8584885 CTTCACCTGCAGGAGGAGCTGGG - Intergenic
926105760 2:10149699-10149721 CTACAACTGCACATGGCACTGGG - Intronic
927151730 2:20200142-20200164 CTGCACCTGCTGATGGAGCAGGG - Intergenic
927202141 2:20584435-20584457 CTGAACCTGCACATGGAATGGGG + Intronic
927948092 2:27149367-27149389 CTGCACCTGCAGAGGGGTCCAGG + Intronic
928114401 2:28536859-28536881 TTGCAGCTGCAGAGGGAATTGGG - Intronic
928850024 2:35734440-35734462 CTGCCCCTCCTGCTGGAACTCGG - Intergenic
929418995 2:41771766-41771788 CAGCACCTGCACATGGAAGGCGG - Intergenic
930088041 2:47512082-47512104 CTGCACCTTCAGCAGGAACCTGG + Intronic
935104496 2:100027424-100027446 CTGAACTTGCAGACTGAACTTGG + Intronic
935106607 2:100050784-100050806 CTGCCCCTGCAGATGCAGATGGG + Intronic
937342369 2:121099448-121099470 CCTCACCTGCAGACGGAACAGGG - Intergenic
938406650 2:131036595-131036617 CTGTCCCTGCAGGTGGGACTGGG - Intronic
938502312 2:131836430-131836452 CTGCTGCTGCTGATGGGACTGGG + Intergenic
944120873 2:196239439-196239461 TTGCATCTGCTGATGGAACTAGG - Intronic
944796892 2:203196216-203196238 CTGCACCTGCAGATGGAACTTGG - Intronic
945208046 2:207353116-207353138 ATCCACCTGCAGATGGTGCTGGG - Intergenic
946401560 2:219471270-219471292 AATGACCTGCAGATGGAACTCGG + Intronic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
947617749 2:231569203-231569225 CGGCACCTGCAGATGGTCCATGG - Intergenic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1171340775 20:24425925-24425947 ATGCAGATGCAGATGGAAATCGG + Intergenic
1172650355 20:36497911-36497933 CTGGACCTGCAGACCAAACTAGG + Intronic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1178223404 21:30686421-30686443 CTGCACCTTTAAATAGAACTAGG + Intergenic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1180966172 22:19789025-19789047 CCCCACCTGCAGCTGGAACCAGG + Intronic
1183513282 22:38248386-38248408 CTGCAGCTGAGGATGGAAGTGGG - Intronic
1183641742 22:39097035-39097057 CTGTACCTGGAGAGGGAATTGGG + Intergenic
1184212200 22:43042727-43042749 CTGCACCTGAAAATGGAGCTGGG + Intronic
1184498567 22:44858323-44858345 ATGCACCCGCAGCGGGAACTTGG + Intronic
1184500261 22:44867329-44867351 ATGCACCTGCAGCGGGAACTTGG - Intergenic
1184902896 22:47458515-47458537 CTGCTTCTGCAGATGGGGCTGGG - Intergenic
949422841 3:3884562-3884584 CTGCACCTTCACATGGCACAAGG - Intronic
950330655 3:12153562-12153584 CGGCACCTGCAGCTGGTACCGGG - Exonic
950440613 3:13008103-13008125 CTGTACCTGAAGATGAAACGGGG + Intronic
950609185 3:14114301-14114323 CTGCAACTGCTGATGGTCCTGGG - Intronic
950762213 3:15241509-15241531 CTGCACCTCCAGTTTGTACTGGG - Exonic
953032830 3:39189296-39189318 TTGCCGCTGCTGATGGAACTTGG + Exonic
953239521 3:41136301-41136323 TTCCCCCTGCAGAAGGAACTGGG - Intergenic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955235319 3:57134239-57134261 CTGGATCTGCTGATGGAAGTTGG - Intronic
956176114 3:66474709-66474731 CTGGACCTGCAAATGGGAGTGGG - Intronic
956462468 3:69485537-69485559 GGGCAGCTGCAGATGCAACTGGG + Intronic
956922501 3:73944665-73944687 CTGCACCTGGAAATGGAATGAGG - Intergenic
958432169 3:94054133-94054155 CTGCAGCTTCTGATGGAACAAGG - Exonic
960537535 3:118829875-118829897 CTGCACCTGCAAATGCAGATTGG - Intergenic
961522566 3:127475511-127475533 GTGCAGCTGCAGATGGGGCTGGG - Intergenic
963680541 3:148370076-148370098 CATTACCTGCAGAGGGAACTGGG + Intergenic
964601256 3:158503559-158503581 CTGCACCTGCTGTTGGAGATGGG + Intronic
964764750 3:160169204-160169226 CTGCAGCTGCAGTAGGAATTTGG + Intergenic
966491368 3:180531660-180531682 CTGCAGCTGCAGCTGCACCTTGG - Intergenic
968538812 4:1151767-1151789 CTGGATCTGCAGCTGGGACTTGG + Intergenic
968641151 4:1715710-1715732 CTGCTCCTGCAGAGGGCCCTGGG + Intergenic
968900626 4:3429970-3429992 CTGCAGCTGCAGCTGGGACCCGG + Intronic
972769736 4:42186093-42186115 TGGCACCTTCAGAGGGAACTTGG + Intergenic
974933291 4:68384948-68384970 CCGCATCTGCAGTGGGAACTGGG - Intergenic
975216919 4:71766310-71766332 CTGCACCTGCACATAAATCTTGG - Intronic
975321064 4:73011124-73011146 CTGCACCTGCACAAGGAACATGG + Intergenic
975523707 4:75326995-75327017 CTGCAGCTGAAGAAGGATCTGGG + Intergenic
976223376 4:82776051-82776073 CAGCACGTGCAGATGTAAATCGG - Intronic
977739692 4:100463655-100463677 CTGCAGCTGGAGATGGGAGTGGG - Intronic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
983491740 4:168397892-168397914 CTGCAGCTGCAGCTGCAGCTTGG - Intronic
985587497 5:748501-748523 CTGCACCTGCACCGGGAACAGGG + Exonic
985602054 5:840592-840614 CTGCACCTGCACCGGGAACAGGG + Exonic
996307192 5:122060796-122060818 CTGCAGGAGCAGATGGAACCAGG - Intronic
998510523 5:142710319-142710341 CTGCATTTGCAGGTGGACCTTGG - Intergenic
999294100 5:150447317-150447339 CTGCTCCTGCAAAGGGAACTAGG + Intronic
1002841655 6:911753-911775 CTGGACCTGCAGCTGGGGCTTGG + Intergenic
1004178192 6:13359029-13359051 CTTCACCTCCAGATGCCACTGGG + Exonic
1005530704 6:26702448-26702470 CAGCACCTAGAGATGGATCTGGG + Intergenic
1005531498 6:26711296-26711318 CAGCACCTAGAGATGGATCTGGG + Intergenic
1005539297 6:26790366-26790388 CAGCACCTAGAGATGGATCTGGG - Intergenic
1005540092 6:26799198-26799220 CAGCACCTAGAGATGGATCTGGG - Intergenic
1007131280 6:39476509-39476531 CTGCACCATCAGAAGGAGCTGGG + Intronic
1008124324 6:47651613-47651635 GAGCACATGCAGATGGAACGTGG + Intergenic
1009010909 6:57841304-57841326 CAGCACCTAGAGATGGATCTGGG - Intergenic
1011979769 6:93358625-93358647 TTGCACCTGCAGTTGGCACCAGG + Intronic
1014547262 6:122747894-122747916 CTCCACCCGCAGAGGGAAGTCGG - Intergenic
1014762335 6:125370631-125370653 CTGCTCCTGCCGTTGGAAGTTGG - Intergenic
1015509179 6:134020768-134020790 TTGCACCTGCAGTTGTAAATTGG + Intronic
1015917356 6:138231022-138231044 CTGCCCCTGCTGATGGAACTGGG + Intronic
1017127922 6:151083048-151083070 CTGCACCTGTAGATGGGAATGGG + Intronic
1024145544 7:46513003-46513025 CAGCAGCAGCAGATGCAACTGGG + Intergenic
1024981484 7:55161112-55161134 CTGCCCCTGCTGAAGGAACCAGG - Intronic
1025807550 7:64849613-64849635 CTGCAGCTGCAGTGGGAAGTGGG + Intergenic
1026393678 7:69928768-69928790 CTGCAGCTGCAGCTGCACCTGGG + Intronic
1029058594 7:97773238-97773260 CTGCACTTGCACCTGGAGCTCGG + Intergenic
1030177392 7:106668932-106668954 CTGCACATGCAAAGGGATCTGGG - Intergenic
1030351352 7:108491359-108491381 CCAGACCTTCAGATGGAACTAGG + Intronic
1031406699 7:121395868-121395890 CTGCACCTGGCGCTGGCACTCGG - Intronic
1031473570 7:122195905-122195927 CTGCACCTGGAGAGGGCACAGGG - Intergenic
1032197086 7:129795545-129795567 CTTCAGCTGCAGAGGGCACTTGG - Intergenic
1033205994 7:139423380-139423402 CTCGACCTGCAGAAGAAACTGGG + Exonic
1034206556 7:149321120-149321142 CTGCACCAGTAGACAGAACTTGG + Intergenic
1035289427 7:157828105-157828127 CCCCACATGCAGATGGAGCTGGG + Intronic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1035608104 8:942475-942497 CTGGACCTGGAGATGGATTTTGG - Intergenic
1036151391 8:6302402-6302424 CTGCACTTGCAGCTGGACTTGGG - Intergenic
1036777196 8:11621560-11621582 CTGCAGCTGGAGATGGAAGATGG - Intergenic
1038195882 8:25367198-25367220 CTGTACCTGGAGACGGACCTTGG + Intronic
1038477008 8:27875610-27875632 CTGCACCTGCTGGTGGTTCTCGG - Intronic
1039397424 8:37238455-37238477 CTCCACCTGCAAATGGCATTGGG + Intergenic
1043266698 8:78275283-78275305 CTGCAGCTGCAAGTGGCACTGGG - Intergenic
1049072979 8:140371358-140371380 CTGCACCTGCAGCTGTGGCTGGG - Intronic
1049560040 8:143305587-143305609 CAGGCCCTGCAGCTGGAACTGGG - Intronic
1049719351 8:144108457-144108479 CTGCACCTGCACAAGGAAGACGG + Exonic
1052290175 9:26831108-26831130 CTGAACTTGTAGAGGGAACTTGG - Intergenic
1059343588 9:113613312-113613334 CTGCACCTGGAGCTGGCTCTCGG - Intergenic
1060321023 9:122561653-122561675 CTGCACCTGGAGATGTCACTGGG + Intergenic
1061661477 9:132133161-132133183 TAGCACCTCCAGAAGGAACTTGG - Intergenic
1062559680 9:137135828-137135850 CTGCACTTACAAATGGAACGTGG - Intergenic
1062697015 9:137880726-137880748 CTGGGCCTGCACATGGGACTGGG - Intronic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187211989 X:17241077-17241099 CATCACCTGCAGTTGGAAGTGGG - Intergenic
1193069683 X:77294908-77294930 CTCCACCTGCAAAGGGAAGTCGG + Intergenic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1199692860 X:150321894-150321916 CTGCTCCTGCAGATGTTTCTGGG - Intergenic
1202112008 Y:21430961-21430983 CAGCACCTGCACAAGGACCTGGG - Intergenic