ID: 944799258

View in Genome Browser
Species Human (GRCh38)
Location 2:203221319-203221341
Sequence GCATCTTTTCAGTGGAAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944799258 Original CRISPR GCATCTTTTCAGTGGAAAGG TGG (reversed) Intronic
900002777 1:24031-24053 GCATCTGTTCAGGGGAGATGGGG - Intergenic
900022498 1:194556-194578 GCATCTGTTCAGGGGAGATGGGG - Intergenic
901138240 1:7011470-7011492 GCATCTTCAGAGTGGATAGGAGG - Intronic
901477842 1:9503184-9503206 GCATTTGTCCAGAGGAAAGGTGG + Intergenic
903198837 1:21716190-21716212 GCTTCCTTTAAGTGGAACGGTGG - Intronic
906328229 1:44862361-44862383 GTAACGTTTCAGTGGAAAGGAGG + Intronic
908139136 1:61164952-61164974 GTATCATTTGGGTGGAAAGGAGG + Intronic
908303888 1:62791079-62791101 GAATATTCTCATTGGAAAGGGGG + Intronic
909310400 1:74139246-74139268 CAAACTTTTCAGTGGAAAGAAGG + Intronic
910221041 1:84889707-84889729 GCATGTTTTGAGTGCTAAGGGGG - Intronic
910332076 1:86085266-86085288 GAATCTTTTCATTGCATAGGAGG - Intronic
910358195 1:86386558-86386580 GCATTTTTTCAGTAGAGATGGGG + Intronic
911430537 1:97780695-97780717 GCTTCTTTTCAGTTAAAAGAAGG - Intronic
911564088 1:99441913-99441935 GCATCTTTTATGTGGGAAGTGGG + Intergenic
916926825 1:169530567-169530589 ACATTTATTCAGTGGAGAGGAGG - Intronic
917246164 1:173003650-173003672 CAGTCTTTTCAGTGGAAAGAAGG - Intergenic
917270616 1:173269431-173269453 GCTTCTTTTAAGTGAAAACGTGG - Intergenic
918081858 1:181214027-181214049 GCATGTTTTCCTTGGAAATGTGG + Intergenic
920506564 1:206519235-206519257 GCTTCCTTTCATTGGAAAAGGGG - Intronic
921566805 1:216731325-216731347 GAATACTTTCAGTGGGAAGGTGG + Intronic
922531889 1:226351143-226351165 GTATCTTTTTAGTGGAGATGGGG + Intergenic
922919363 1:229288577-229288599 GCATCTTCTCAATGGAATGTTGG + Intronic
923005886 1:230049321-230049343 GGGTCTTTTCATTGGAAAGGAGG + Intergenic
923495521 1:234521179-234521201 ACATCTTTTCAGTGATAAGGTGG - Intergenic
924564073 1:245181359-245181381 GCGTCTTTTCATTTGAAAGTAGG + Intronic
924615243 1:245606888-245606910 GCATTTTTTTAGTAGAGAGGGGG - Intronic
1063599177 10:7464441-7464463 TCATCTTTTGAGTGGGAAAGAGG - Intergenic
1063850038 10:10177612-10177634 GAATCTATTAAGTGGAAAGAAGG - Intergenic
1063982671 10:11468414-11468436 CCATGTTTTCAGTGAAAAAGAGG - Intronic
1064372468 10:14764603-14764625 CCATATTTTCTTTGGAAAGGAGG + Intronic
1064464888 10:15569076-15569098 GCATTTTTCCAGTGGGAAGTGGG + Intronic
1065068486 10:21998571-21998593 GCATCTTTTCAGAGGAGATGGGG - Intronic
1066307194 10:34156926-34156948 GCATTCTTTCAGTGGAAAAAAGG + Intronic
1066636104 10:37503065-37503087 TGTTCTTTTCAGTGAAAAGGAGG - Intergenic
1068640720 10:59403531-59403553 GCATACTTTCAGTAGAAATGGGG - Intergenic
1072918858 10:99558662-99558684 GCATCCTCTCAGTGTGAAGGCGG - Intergenic
1074291785 10:112143134-112143156 TCATATTTTTAGTGGAAATGGGG + Intergenic
1075437761 10:122458242-122458264 GGATTTTTCCAGAGGAAAGGGGG - Intergenic
1076256155 10:129026170-129026192 GCATCTTTTCAACAGTAAGGGGG - Intergenic
1076854822 10:133110981-133111003 GAATCTGTTAAGTGGAAATGTGG + Intronic
1078915511 11:15774996-15775018 GCATCTGTCCAGTGGACAGGGGG + Intergenic
1081389637 11:42514596-42514618 GCTTTATTTCAGTGAAAAGGTGG + Intergenic
1082719224 11:56653057-56653079 GGAACTTTTCAGTGGACAGCGGG - Intergenic
1083096899 11:60260203-60260225 CAATCATTGCAGTGGAAAGGGGG - Intergenic
1084309073 11:68305613-68305635 TCATATTTTCAGTAGAAATGGGG + Intergenic
1086120900 11:83303779-83303801 GCTTCTGCTCAGGGGAAAGGAGG + Intergenic
1087327473 11:96741317-96741339 GCATCTTAGCAGTGGACAGTTGG + Intergenic
1087975524 11:104541233-104541255 GCATTTCTTTAGAGGAAAGGAGG - Intergenic
1088832102 11:113546090-113546112 GCTTCCTTTAAGTGAAAAGGTGG + Intergenic
1091159986 11:133411355-133411377 TCATGTTTTCAAAGGAAAGGAGG - Intronic
1091376196 12:26094-26116 GCATCTGTTCAGGGGAGATGGGG - Intergenic
1091415555 12:279965-279987 GTATCTTGTCAGTGGGGAGGGGG - Intergenic
1092547969 12:9467979-9468001 TCATCTTCTTAGTGGAATGGGGG + Intergenic
1092604115 12:10100585-10100607 TCATATTTTCAGTAGAAACGGGG - Intronic
1094106314 12:26815368-26815390 GCATGTTTTCATTGGACAGCTGG - Intronic
1094505018 12:31054387-31054409 TCATCTTCTTAGTGGAATGGGGG - Intergenic
1095299845 12:40571586-40571608 GCATTTTTTTAGTGGAGATGGGG - Intergenic
1096211213 12:49767291-49767313 TCATATTTTTAGTAGAAAGGGGG + Intergenic
1096427290 12:51514764-51514786 ACATCTTTTCATCAGAAAGGAGG + Exonic
1097502335 12:60420099-60420121 GCAGTTTTTCAGTGCAAAGAAGG + Intergenic
1100037568 12:90271730-90271752 GCATCATTTCAGTGTAATTGAGG + Intergenic
1100100803 12:91102210-91102232 TCATCTTTTCAGGGCAAAGCTGG - Intergenic
1100444010 12:94644278-94644300 TCATGTTTTCAGTGGAGGGGAGG - Intronic
1102330878 12:112029220-112029242 ACATCTTTTCAGGGGAGCGGGGG - Exonic
1103071107 12:117943019-117943041 TCAACTTTTCAGGGGAAATGAGG + Intronic
1105223594 13:18357489-18357511 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1106202781 13:27555252-27555274 GCATCTTTTCATGGGAAAACTGG + Intronic
1106255183 13:28015958-28015980 ACCTCTTTCCAGTGGAAAGATGG - Intronic
1106656493 13:31752401-31752423 GAATCTCTGAAGTGGAAAGGAGG + Intronic
1109227546 13:59714614-59714636 GCATCTTATTAGAGGAAGGGGGG - Intronic
1110672916 13:78203417-78203439 GCTTCGTCTCAGTGGGAAGGAGG + Intergenic
1112436211 13:99392985-99393007 GCCTTTTTTCAGGGGAGAGGAGG - Intergenic
1113077706 13:106484288-106484310 GCAGCTGTCCATTGGAAAGGTGG - Intergenic
1113548336 13:111172366-111172388 GCATCGTCTCTGTGGAAATGTGG + Intronic
1114290588 14:21285250-21285272 GCATCTTTTCATTTGCCAGGAGG - Intergenic
1120978212 14:90267924-90267946 GCAGCTTTTCAGGGGAAACTGGG + Exonic
1122958725 14:105084823-105084845 GCATCACTTCACTGGACAGGTGG - Intergenic
1123462360 15:20484873-20484895 TAAGGTTTTCAGTGGAAAGGAGG + Intergenic
1124566187 15:30816518-30816540 GCCTCCTCTCAGGGGAAAGGGGG + Intergenic
1127261472 15:57329773-57329795 GCATTTTTTCCCTGCAAAGGAGG + Intergenic
1127838976 15:62813501-62813523 GGATCTTTTCAGTCTCAAGGGGG - Intronic
1129514099 15:76146273-76146295 CCATCTTTTTAGTGAAAAGAGGG + Intronic
1132325378 15:100964382-100964404 GCATCCTTCCAGTGGAAGGCTGG + Intronic
1132450734 15:101966908-101966930 GCATCTGTTCAGGGGAGATGGGG + Intergenic
1133397510 16:5460101-5460123 GCATGTTTTTAGTGTAAAGTCGG + Intergenic
1133397511 16:5460123-5460145 GCATGTTTTTAGTGTAAAGTCGG + Intergenic
1133495546 16:6313987-6314009 GGTTCTTATTAGTGGAAAGGAGG + Intronic
1135641725 16:24125530-24125552 GCAACTTTTCAGTGGGTAGTTGG - Intronic
1140808107 16:78552197-78552219 TCATCTTTTGAGGGGAAATGGGG - Intronic
1203142867 16_KI270728v1_random:1780350-1780372 CCATCTATTCAATGGACAGGAGG - Intergenic
1143563075 17:7706455-7706477 GCCTCTTTTCAGAGCAAAGCTGG - Intronic
1143979504 17:10856239-10856261 GAAACTTTGGAGTGGAAAGGCGG + Intergenic
1144290731 17:13823668-13823690 GCACAGTTTCAGTGGAGAGGAGG + Intergenic
1146043302 17:29478950-29478972 TCATATTTTCAGTGGAGACGAGG - Intronic
1146235313 17:31154677-31154699 GCATTTTTAGAGTGTAAAGGAGG - Intronic
1148924617 17:51073151-51073173 GCATTTTTTCAGTAGAGATGGGG - Intronic
1152062376 17:78087166-78087188 GCAGCATTTCAGTGGTTAGGAGG + Intronic
1153096971 18:1418158-1418180 GAATCATTTCAGTGGAGATGGGG + Intergenic
1153854428 18:9131928-9131950 GCATGTTTACAGATGAAAGGGGG + Intronic
1155838339 18:30615052-30615074 GTATGTTTTTAGTGGAAACGGGG + Intergenic
1159328288 18:66953130-66953152 TCATGTGTTCAGTGGATAGGTGG + Intergenic
1159938422 18:74387061-74387083 GGATATTTTCAGTGGAGAGATGG - Intergenic
1160510129 18:79448817-79448839 GCAGCTTTTCATTGGGACGGCGG + Exonic
1160542152 18:79629785-79629807 CCACATTGTCAGTGGAAAGGTGG + Intergenic
1160634528 19:65639-65661 GCATCTGTTCAGGGGAGATGGGG - Intergenic
1160807609 19:999458-999480 GCATTTTCTCAGTGGCAAGCAGG + Intergenic
1164817042 19:31212281-31212303 GCATCTTTTCAGTAGAGACAGGG - Intergenic
1164820955 19:31250992-31251014 TCAGCTTCCCAGTGGAAAGGTGG - Intergenic
1167394473 19:49218997-49219019 GCAGGTTTTCAGAGGAAAGGAGG + Intergenic
1168474646 19:56667080-56667102 GCACATTTTCAGTGGAAAGCAGG + Intronic
926311494 2:11679042-11679064 GCATCTTCCCAGTGGACAGGTGG + Intronic
926632760 2:15152020-15152042 GCATTTTTTTAGTAGAGAGGGGG + Intergenic
927344026 2:22015777-22015799 CCAACTTTTCAGTGGCATGGTGG - Intergenic
928345457 2:30489836-30489858 GCATGTTTTAAGTGTAATGGTGG - Intronic
929362047 2:41103604-41103626 CAATCATTTCAGTTGAAAGGAGG + Intergenic
934748900 2:96779130-96779152 GCATTTTTTCAGTAGAGACGGGG + Intronic
934792089 2:97070051-97070073 CCATCTTTTCAGTGTCATGGAGG + Intergenic
936152791 2:110030834-110030856 TCAGCTGTTAAGTGGAAAGGAGG + Intergenic
936191889 2:110340578-110340600 TCAGCTGTTAAGTGGAAAGGAGG - Intergenic
936566947 2:113589388-113589410 GCATCTGTTCAGGGGAGATGGGG + Intergenic
939564122 2:143766514-143766536 GCTTCCATTCAGTGGAAAGGTGG + Intronic
942254861 2:174086508-174086530 GCTTCCTTTAAGTGAAAAGGTGG - Intronic
943551665 2:189347956-189347978 GCATGTTTTCAGTGAAAAGAAGG + Intergenic
944799258 2:203221319-203221341 GCATCTTTTCAGTGGAAAGGTGG - Intronic
947157565 2:227177959-227177981 GCATCCTTTAAGTGAAAAAGTGG + Intronic
947793590 2:232880956-232880978 GCCTCTCTTCAGTGTAAAGGAGG - Intronic
948938276 2:241182545-241182567 CCATCTTCTGAGTGGGAAGGAGG + Intronic
1169540720 20:6596775-6596797 ACATCTTTATAATGGAAAGGCGG - Intergenic
1171793328 20:29547949-29547971 GCATGTGCCCAGTGGAAAGGGGG - Intergenic
1171879195 20:30604106-30604128 GCATCTTTCCCGTGGAATGATGG - Intergenic
1173312828 20:41915985-41916007 TCATCTTGTCAGTGGACTGGTGG - Intergenic
1173953840 20:47015466-47015488 TCATCTTTGCAGAGGAAGGGTGG + Intronic
1176732137 21:10509870-10509892 GCATTGTTTCAGGTGAAAGGTGG + Intergenic
1177179794 21:17732846-17732868 GCATCTTAGAAGTGGAAGGGAGG - Intergenic
1177733456 21:25059137-25059159 GCATTTTTTTAGTGGAGATGGGG - Intergenic
1177812746 21:25942209-25942231 GCATCTTTTCATTGAAAATGCGG - Intronic
1178041868 21:28648265-28648287 GGATTTTTCCAGTGGAAAGTGGG - Intergenic
1178258716 21:31079028-31079050 CCATCTTTTCAGTTCAAAGTTGG + Intergenic
1178352679 21:31884087-31884109 TCATCTCTTCATGGGAAAGGTGG + Intronic
1179630928 21:42678313-42678335 GCATCTATTCAGTCCAAATGTGG - Intronic
1180683149 22:17643160-17643182 GCCTGTTTTAATTGGAAAGGGGG + Intronic
1182850977 22:33473990-33474012 ACATCTTTGGAGGGGAAAGGAGG + Intronic
1185162448 22:49238084-49238106 GCATCATTTTATTAGAAAGGGGG + Intergenic
949772464 3:7594114-7594136 ACATCATTTCAGAAGAAAGGAGG - Intronic
949841148 3:8321408-8321430 GCAGCTTTGCAGTGGAATAGTGG - Intergenic
950688389 3:14635630-14635652 TCATGTTTTCAGTGGAAGGGGGG + Intergenic
951677273 3:25256216-25256238 GTATCTTTTCAGTGGAATATTGG - Intronic
952524260 3:34193659-34193681 GCTTCCTTTAAGTGAAAAGGTGG + Intergenic
952846808 3:37694745-37694767 TCCTCTTTTAAGGGGAAAGGGGG + Intronic
955901491 3:63760317-63760339 GCTTGTTTTCAGGGAAAAGGAGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957649288 3:82978655-82978677 GCCTCTGTACAGAGGAAAGGAGG - Intergenic
958814303 3:98899911-98899933 ACATCTCTACAGTGGAAAGAAGG + Intronic
959403204 3:105928637-105928659 GCTTCTTTTGAGTGAAAAGCTGG + Intergenic
960078160 3:113512382-113512404 AAAGCTTTTCAGTGCAAAGGTGG - Intronic
960593589 3:119388599-119388621 GCATCTTAGCAGTGGGAAGGAGG + Intronic
960893169 3:122472906-122472928 TCATATTTTTAGTGGAAACGGGG - Intronic
961914137 3:130352682-130352704 GCATCTCCTTAGTGGAGAGGGGG + Intronic
962736932 3:138333678-138333700 GTATCTATACTGTGGAAAGGGGG - Intergenic
964335894 3:155654024-155654046 GCCTGGTTTCAGTGGAGAGGTGG - Intronic
965207851 3:165744579-165744601 GAATCTTTTCAGTGGATAGGAGG + Intergenic
965601625 3:170460441-170460463 GCATCTTTGCTTTGGAAAGTGGG + Exonic
969504997 4:7580307-7580329 GCATCTTTTTAGTAGAGATGGGG - Intronic
970368050 4:15380760-15380782 TCATATTTTCAGTAGAAATGGGG - Intronic
974425235 4:61734180-61734202 GTATGTTTTCAATGGAAAAGGGG - Intronic
974832194 4:67203304-67203326 GCATATTTTCAAGTGAAAGGGGG + Intergenic
976575674 4:86668097-86668119 GCAACTTTTCTGTGGAATGTTGG + Intronic
978990333 4:115073416-115073438 GCATCTTATCAGTGGATAAACGG + Intronic
979034015 4:115688793-115688815 GCATCATTTAAGTGCAAAGTGGG - Intergenic
979057193 4:116011545-116011567 TCATCTTTTCAGTGTGAACGAGG + Intergenic
979611261 4:122691209-122691231 GCATCTATGCAGGGGAAAGCAGG - Intergenic
980047630 4:128006289-128006311 GAATTTTTTCAGTAGAAAGCTGG - Intronic
981715267 4:147745960-147745982 GCATCTTTTTAGTAGAGATGGGG + Intronic
981733675 4:147926338-147926360 GAATATTTGCAGTGGAAAGAAGG + Intronic
982217231 4:153092900-153092922 AGATCTTTTCAGTGGGAAGCTGG - Intergenic
982586144 4:157242579-157242601 GATTCTTTTCAGGGGAAAAGTGG - Intronic
982711312 4:158761068-158761090 GCATCTAATCACTGGCAAGGGGG - Intergenic
983585371 4:169348562-169348584 CCATCTTTCCAGTCAAAAGGCGG - Intergenic
983978947 4:173970625-173970647 GCATTTTTTCAGTAGAGACGGGG - Intergenic
984694787 4:182768797-182768819 GCATCTCATCAGTGGAAGAGCGG + Intronic
989182868 5:38595908-38595930 GCATTTTTTCAGTAGAGACGGGG + Intronic
989203538 5:38789271-38789293 GCATCATGTCAGTGGAAACATGG - Intergenic
991112383 5:62915559-62915581 ATATCCTTTCAGTGGAAAGCAGG + Intergenic
992971116 5:82059074-82059096 GCATATTTTCAAGGGAAAAGGGG - Intronic
993712381 5:91239068-91239090 GTATTTTTTCAGTGGAGACGGGG + Intergenic
994329037 5:98484653-98484675 GCATCCTTCCAGCAGAAAGGAGG + Intergenic
996891972 5:128431631-128431653 TCATCTTTTCATTTAAAAGGGGG + Intronic
997736103 5:136213682-136213704 GCATCCTTCCAGTGGAATGTCGG + Intronic
997925585 5:138028277-138028299 GCATGTTTTCAGTGGAGAAAAGG - Intronic
1000131031 5:158299814-158299836 ACTTCTTTACAGTGGAAAGCAGG + Intergenic
1000907520 5:166980329-166980351 GCATCTTGTCAATGGAGGGGAGG + Intergenic
1001549741 5:172594326-172594348 GCATTTTTTTAGTAGAAATGGGG + Intergenic
1003308737 6:4950582-4950604 GCTTCTTCTCAGTGAAAAGACGG - Intronic
1005175492 6:23040062-23040084 CCATATTTTCAGTGGGAAAGGGG + Intergenic
1005427644 6:25719765-25719787 GAATCTCTTCATTGGTAAGGTGG + Intergenic
1007307279 6:40917044-40917066 GCATTTTCTCAGTGGAGAGAAGG + Intergenic
1008051172 6:46901811-46901833 GGAACTGTTCACTGGAAAGGAGG - Intronic
1008168221 6:48167308-48167330 GCATTTTTTAAGTGAAAAGGGGG + Intergenic
1012354485 6:98296789-98296811 GCATGTTTTCAAAGGAAAAGAGG + Intergenic
1014341233 6:120209949-120209971 GCATGTTTTCACTTGTAAGGGGG + Intergenic
1016334461 6:142989505-142989527 GCATGTTTTCAGTAGAAATGGGG + Intergenic
1017950946 6:159134492-159134514 GGGTCTTTGCGGTGGAAAGGCGG - Intergenic
1018717627 6:166545877-166545899 ACGTCTTTTCTGTGGGAAGGAGG - Intronic
1021227105 7:18040882-18040904 TCATCTTTTCACTTGAAATGTGG + Intergenic
1022152956 7:27627607-27627629 GCCTATTTTAAGTGGGAAGGTGG + Intronic
1022860170 7:34359125-34359147 GGATCTCATCAGTGGAAAGTAGG - Intergenic
1023770121 7:43549580-43549602 TCATCTTTTCACAGGCAAGGAGG - Intronic
1024662613 7:51512613-51512635 GCATATTTTTAGTAGAGAGGGGG + Intergenic
1025300871 7:57818953-57818975 GCATGTGCCCAGTGGAAAGGCGG - Intergenic
1030079472 7:105764760-105764782 GTAACTTTTCAATGGACAGGAGG + Intronic
1030380797 7:108809642-108809664 ACATCTTTTCAGTGGAAGGAAGG + Intergenic
1030768486 7:113441894-113441916 ACAGTTTTCCAGTGGAAAGGTGG + Intergenic
1030771884 7:113485360-113485382 CCATCTTTTTAATGGAAAGATGG - Intergenic
1031603733 7:123745326-123745348 GAAAATTTTCAGGGGAAAGGTGG - Intronic
1031726700 7:125248815-125248837 GGACCTTTTCAGTGAAAAGAAGG - Intergenic
1032101383 7:128981392-128981414 GCATCTTTGAAGTGAAGAGGAGG - Intronic
1032275861 7:130454772-130454794 ACAGCTTCTCAGTGGCAAGGAGG + Intergenic
1033793818 7:144823600-144823622 GAGTCTTTTCAGTGGAACGCTGG - Intronic
1034082192 7:148289238-148289260 GAATCTTTTCTGTGAAAAGCAGG + Intronic
1034597446 7:152211534-152211556 GCATTGTTTCAGGTGAAAGGTGG - Intronic
1035745946 8:1962204-1962226 TCATCCTTTCAGTTGGAAGGAGG + Intergenic
1037926286 8:22846324-22846346 CCTTCTTTTGAGTGGAAAAGGGG + Intronic
1038268410 8:26053815-26053837 GCATTTTTTCAGTAGAGATGAGG + Intergenic
1038281596 8:26170342-26170364 GCATCCTCTCAGTGGGAAAGGGG - Intergenic
1039516700 8:38139862-38139884 GCAGATTTTCACAGGAAAGGGGG - Exonic
1039799522 8:40942115-40942137 TCATATTTTCAGTGGAGACGGGG + Intergenic
1043940977 8:86195439-86195461 GCATCCTTTCAGTGGAATCCTGG + Intergenic
1044020895 8:87104575-87104597 GCCTCTTTTCTTTGGAAATGGGG - Intronic
1046008154 8:108511251-108511273 GCATATTTAAAATGGAAAGGGGG - Intergenic
1046547581 8:115670228-115670250 GCATCTTTTTAGAGAAAAGATGG + Intronic
1047056397 8:121169418-121169440 GCAAAGTTTCAGTGGAAGGGTGG - Intergenic
1048404343 8:134104753-134104775 ATATCTTTTCAGGGGGAAGGGGG - Intergenic
1048625653 8:136182293-136182315 GAATCTTTTCTGTGTGAAGGGGG - Intergenic
1049885582 9:24144-24166 GCATCTGTTCAGGGGAGATGGGG - Intergenic
1050213898 9:3299169-3299191 GAATTTTTTCAGTGGAGAGATGG - Intronic
1050369193 9:4903125-4903147 GTATTTTTTCAGTGGACACGGGG + Intergenic
1050703023 9:8362724-8362746 GCATCTTCTCAGAGGAAAACTGG - Intronic
1050936291 9:11399798-11399820 GCAGCCATTCAGTGGAAAGTAGG - Intergenic
1052230686 9:26147679-26147701 TCAAATTTTTAGTGGAAAGGAGG - Intergenic
1053175530 9:35920159-35920181 GGATCTTCTGAGTGGAAAAGTGG + Intergenic
1055141520 9:72882180-72882202 ACAGGTTTTCAGTTGAAAGGGGG - Intergenic
1056450292 9:86710166-86710188 GTATTTTTTTAGTAGAAAGGGGG + Intergenic
1057044254 9:91872738-91872760 GCAGCTCTTCAGTAGAAATGAGG + Intronic
1059763728 9:117363448-117363470 GCATCTTTATGGTGGAAGGGAGG + Intronic
1062702074 9:137912421-137912443 GTAGCATTTCAGTGGAGAGGTGG + Intronic
1186530163 X:10287178-10287200 GCTTATTTTCAGGAGAAAGGTGG + Intergenic
1188341019 X:29002072-29002094 GTATCTTTTTAGTAGAAACGGGG + Intronic
1190443629 X:50501057-50501079 GCATTATTTCAGTGTAAATGTGG - Intergenic
1191102330 X:56744978-56745000 GCTTCCTTTAAGTGAAAAGGAGG - Intergenic
1192532047 X:71896468-71896490 GCATCTGTCCAGTGAAAATGGGG + Intergenic
1193102206 X:77627049-77627071 GTATTTTTTTAGTGGAAACGGGG - Intronic
1193738996 X:85195277-85195299 ACATATTTTCAGTGGAGTGGTGG + Intergenic
1194260972 X:91695224-91695246 GCATGTTTTCACTTTAAAGGGGG - Intergenic
1196119821 X:112037849-112037871 GCATCTTTGCAGTAGAAGGTTGG - Intronic
1196213239 X:113019931-113019953 GCATCTTTTGAGAAGAAAGCAGG - Intergenic
1196366912 X:114933816-114933838 ACATCTTTTCATCAGAAAGGAGG - Intergenic
1197965644 X:132057863-132057885 GCATCATTTCAGTGCAAAACTGG - Intergenic
1198585220 X:138113238-138113260 GCATTTTTTCAGTAGAGACGGGG + Intergenic
1199514470 X:148660623-148660645 GCACATTTTCAGTGCACAGGAGG - Intronic
1201327515 Y:12779665-12779687 GCATCCTTTCTGTGGAATAGGGG - Intronic
1201395910 Y:13548485-13548507 TCATATTTTCAGTGGAGATGGGG + Intergenic