ID: 944804348

View in Genome Browser
Species Human (GRCh38)
Location 2:203266557-203266579
Sequence CTGGCTGAGGGGCACGTGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 231}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944804348_944804355 17 Left 944804348 2:203266557-203266579 CCCAGCACGTGCCCCTCAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 231
Right 944804355 2:203266597-203266619 TATGAAGTCTGTTACACAGATGG 0: 1
1: 0
2: 1
3: 24
4: 195
944804348_944804357 24 Left 944804348 2:203266557-203266579 CCCAGCACGTGCCCCTCAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 231
Right 944804357 2:203266604-203266626 TCTGTTACACAGATGGTAATGGG 0: 1
1: 0
2: 2
3: 12
4: 202
944804348_944804356 23 Left 944804348 2:203266557-203266579 CCCAGCACGTGCCCCTCAGCCAG 0: 1
1: 0
2: 3
3: 27
4: 231
Right 944804356 2:203266603-203266625 GTCTGTTACACAGATGGTAATGG 0: 1
1: 1
2: 0
3: 5
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944804348 Original CRISPR CTGGCTGAGGGGCACGTGCT GGG (reversed) Exonic
900022636 1:195349-195371 CTGGATGAGGGGCACGGCATAGG + Intergenic
900396910 1:2456829-2456851 CCAGCGGAGGGGCCCGTGCTGGG + Intronic
900676008 1:3886742-3886764 GGGGCTGAGGGTCACCTGCTGGG + Intergenic
900931879 1:5743013-5743035 CTGGCTGATGGGGCCGTGGTGGG - Intergenic
901292823 1:8137487-8137509 CTTGCTGGGAGGCAGGTGCTTGG + Intergenic
901740107 1:11336053-11336075 CTGGTTGAGGGGCACAGGCAGGG + Intergenic
901759006 1:11458731-11458753 TGGGCTGGGGGGCACCTGCTGGG + Intergenic
901859282 1:12063835-12063857 CTGGCTGAAGGGCTAGTGGTGGG + Intronic
902601864 1:17545369-17545391 ATTGCTGAGGGGCAGCTGCTGGG + Intronic
903296449 1:22346296-22346318 CTGGCTGAGGGACTCGTGAGAGG - Intergenic
903967724 1:27100693-27100715 GCGGCCGAGTGGCACGTGCTGGG - Intronic
906294861 1:44643452-44643474 CTGGCTGAGGAGCCTGGGCTTGG + Intronic
909002510 1:70236177-70236199 CTGGGTGATGGGTACATGCTTGG - Intronic
912245886 1:107961373-107961395 CTGGGTGGGCGGCACATGCTGGG - Intronic
912470190 1:109901426-109901448 CTGGCTTAAGGTTACGTGCTGGG - Intergenic
913039801 1:115011317-115011339 CAGGCTGAGGGTGACATGCTTGG + Intergenic
915925089 1:160011178-160011200 CTGGCTGAAGGGCTCCTCCTGGG - Intergenic
920176927 1:204107810-204107832 CTGGCTCAACGGCAGGTGCTGGG - Intronic
920306152 1:205019357-205019379 CTGGCTGGGAGGAAAGTGCTGGG + Exonic
921470592 1:215543516-215543538 CTGGAGGAGGGGCAAGTGCATGG + Intergenic
923630784 1:235648717-235648739 CCGGCTGAGAGGCACGGGCCCGG + Intronic
923976951 1:239274645-239274667 GTGGCTGGGGGGCACTTTCTGGG - Intergenic
1066676314 10:37891334-37891356 CTGGCAGAGGGGCAAGAGCAGGG - Intergenic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1069757419 10:70781802-70781824 TTGGATGTGGGTCACGTGCTGGG + Exonic
1069847104 10:71379959-71379981 CAGGTTAAGGGGCACATGCTTGG - Intergenic
1069914905 10:71781468-71781490 CTGGTGGAGAGGCAGGTGCTGGG + Intronic
1070625839 10:78050350-78050372 GGGGCTGAGGAGCACCTGCTGGG + Intronic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1073439931 10:103546503-103546525 GTGGCAGAGGGGCAGGTGTTGGG + Intronic
1076707618 10:132310227-132310249 CTGACTGAGAGGCAGGTGCCTGG - Intronic
1076864176 10:133159331-133159353 CTGGGAGTGGGGCAGGTGCTGGG - Intergenic
1077015076 11:395762-395784 CTGGCTGAGGGGCTCAGGGTGGG - Intronic
1077170869 11:1165165-1165187 CTGGCTGAGGCCCCCGTCCTGGG + Intronic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1081151965 11:39644108-39644130 CTGGGTGAGGGGCACAGGATGGG - Intergenic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1083624465 11:64065063-64065085 CTGGCTCAGGTGCCTGTGCTGGG - Intronic
1083854319 11:65385105-65385127 CTGGATGCGGGGCTTGTGCTAGG - Intergenic
1083925097 11:65801248-65801270 CTGGCTGGGGGTCATTTGCTGGG + Intergenic
1084359922 11:68662536-68662558 TTGGCTTGGGGGCACCTGCTGGG - Intergenic
1084383996 11:68830649-68830671 CTGGCGGAGGGGCAGGTGACAGG - Intronic
1084459025 11:69286031-69286053 CAGGCTGAGGGGCAGCTGCAGGG - Intergenic
1084667948 11:70586572-70586594 CTGGCCAAGGGGCACATGCTGGG + Intronic
1085516366 11:77114195-77114217 CTGGCTGGGGAGCATGAGCTGGG + Intronic
1089384408 11:118058525-118058547 CAGGGTGAGAGGCACGTGCCTGG + Intergenic
1089540927 11:119188555-119188577 CGTGCTGAGGGGCAGGGGCTAGG + Intronic
1090397612 11:126429509-126429531 ATGGCTGAGGGGCATGTGACAGG - Intronic
1091309225 11:134560990-134561012 CTGGCTGAGTGGCAGTGGCTGGG + Intergenic
1091376334 12:26887-26909 CTGGATGAGGGGCACGGCATAGG + Intergenic
1091800075 12:3319633-3319655 CAGGCTGAAGGGCACCGGCTGGG - Intergenic
1095491575 12:42739997-42740019 GTAGCTGAGGGGCCAGTGCTCGG + Intergenic
1096555089 12:52398924-52398946 CAGGCTGAGCAGCAGGTGCTAGG - Intronic
1096609510 12:52791635-52791657 ATTGCTGAGGGGCAGGGGCTAGG - Intronic
1096842678 12:54389223-54389245 CTGGCTGGGTGTCACATGCTAGG + Intronic
1096939236 12:55324083-55324105 CAGGCTGGGTGGCATGTGCTTGG - Intergenic
1101529631 12:105562320-105562342 CTGGCTCAGGGCCACTGGCTGGG + Intergenic
1102219622 12:111185785-111185807 CTGGCCGAGGGGGACAAGCTGGG + Intronic
1102702620 12:114852735-114852757 CTGGGTGCTGGGCACATGCTGGG - Intergenic
1103555975 12:121766645-121766667 TTGGCTGGGGGTCATGTGCTTGG + Intronic
1103976760 12:124707694-124707716 CTAGCAGAGGGCCATGTGCTGGG + Intergenic
1104090378 12:125511919-125511941 CTGGATGAGGGACACTTCCTAGG - Intronic
1108592420 13:51923490-51923512 CTGCCTGAGGGTCTGGTGCTTGG - Intergenic
1110938329 13:81319402-81319424 CTGGATGAGGGACAAGAGCTTGG + Intergenic
1111637170 13:90920152-90920174 CTGGCTTGGTGGCACGTGCCTGG + Intergenic
1113166376 13:107448101-107448123 CTGACTGAGAGGCAGGGGCTCGG - Intronic
1114043559 14:18702208-18702230 CTGGCTGAGGGGCTGGGCCTGGG - Intergenic
1114114678 14:19508993-19509015 CTGGCTGAGGGGCTGGGCCTGGG + Intergenic
1114183305 14:20382776-20382798 CTGGCAGAGGGGCTGGTGCTGGG - Intronic
1114980421 14:28157649-28157671 CTGGATGAGGGGAACGTGGTGGG + Intergenic
1117288140 14:54307245-54307267 CTGGCTGAGAGGCAGTGGCTAGG - Intergenic
1118918711 14:70130349-70130371 ATGGCTGGGGGGCAGATGCTGGG + Intronic
1120204712 14:81575129-81575151 CTTGGTGAGGTGCACCTGCTGGG - Intergenic
1121564412 14:94897934-94897956 CTGGCTGAAGGGCACCAGCTAGG + Intergenic
1121576528 14:94993298-94993320 CTGACTGAGAGGCAGGTGTTTGG - Intergenic
1122075303 14:99231602-99231624 CTGTGTGAGGGGCACGGGGTGGG + Intronic
1122235245 14:100327586-100327608 CTTCCTGAGGGGGCCGTGCTGGG - Intronic
1122673099 14:103386745-103386767 CTAGCTGAGGGACACCCGCTGGG + Intronic
1122843660 14:104478948-104478970 CTGGCTCTGGGGCACTTCCTGGG - Intronic
1123939874 15:25211648-25211670 CTGGCTGACGGACACTTGCCAGG - Intergenic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1127788215 15:62375093-62375115 CTGGCTGTGTGGCGCGTGGTTGG + Intergenic
1128605706 15:69035380-69035402 CTGGCTGCGGGCCACGTGGCTGG + Exonic
1129389166 15:75212011-75212033 CTGGCTGATGGGCTCTGGCTTGG - Exonic
1129389242 15:75212429-75212451 CTGGGAGAGAGGCACGTGCTGGG - Intergenic
1129656175 15:77527023-77527045 CTGTCTCAGGGGCTCGAGCTGGG - Intergenic
1129692229 15:77720360-77720382 CAGGCAGAGGGGCAGGTGCGTGG - Intronic
1131108606 15:89750675-89750697 CAGGCTGAGGGGCAGGGGCAGGG - Exonic
1131352308 15:91712588-91712610 CAGTCAGAGGGGCACCTGCTGGG - Intergenic
1132450594 15:101966115-101966137 CTGGATGAGGGGCACGGCATAGG - Intergenic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1132481846 16:170278-170300 CTTGCTGTGGGGCAGGGGCTGGG - Intergenic
1132592084 16:730494-730516 CTGGCTGCAGGGCACGGACTCGG - Exonic
1132629117 16:908389-908411 CTGGCTGAGGGGTGCGTGAGTGG - Intronic
1132895420 16:2226910-2226932 CTGGCTGAGAGGCAAATGCAGGG - Intronic
1133235426 16:4385310-4385332 GTGGCTGGGGAGCAGGTGCTGGG - Intronic
1134673419 16:16072690-16072712 CTGGCTCAGGGGGATGGGCTGGG - Intronic
1135569158 16:23535060-23535082 CTGGTAGAGGAGCAGGTGCTTGG + Exonic
1135974867 16:27101927-27101949 GTGGCTGAGTGTCAGGTGCTTGG - Intergenic
1136922609 16:34344903-34344925 CTGGCTGATGGGCACACCCTGGG - Intergenic
1136981964 16:35066903-35066925 CTGGCTGATGGGCACACCCTGGG + Intergenic
1137744445 16:50810452-50810474 CTAGCTGAGGGGACAGTGCTGGG - Intergenic
1137936201 16:52637719-52637741 CTGGCAGAGGGGGAGTTGCTTGG + Intergenic
1139337745 16:66244999-66245021 CAGGCTGAGGGGACAGTGCTTGG - Intergenic
1139582550 16:67881974-67881996 CTGGCTGAGGGGCAGCAGCGGGG + Exonic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1141482865 16:84318451-84318473 TTGGCTGAAGGGCCCGTGCATGG - Intronic
1142470609 17:161360-161382 CTGGCTCGGTGGCAGGTGCTGGG - Intronic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142581700 17:947061-947083 CTGAGTGGGGGGCCCGTGCTGGG - Intronic
1144862617 17:18315080-18315102 GTGGCAGAGGGGAACGTGCTTGG - Intergenic
1145003380 17:19321152-19321174 CTGTATGTGGGGCACTTGCTGGG - Intronic
1146229086 17:31093152-31093174 CTGGCTGATTAGCGCGTGCTTGG + Intergenic
1146492655 17:33293257-33293279 CGAGCTGAGGAGCAGGTGCTCGG - Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147310926 17:39595844-39595866 CTGGTGGAGGGGCAGGTGCCAGG + Intergenic
1147705408 17:42422173-42422195 CTGGCTGCGGGGCCCGGGCCTGG - Intronic
1148073177 17:44920596-44920618 TTGGCGGAGGGGCAGGAGCTGGG + Intergenic
1149785630 17:59432398-59432420 CAGGCTTAGTGGCACGTGCCTGG + Intergenic
1149981745 17:61316466-61316488 CTGGGTGAGGGGCATGTCCGGGG - Intronic
1152538821 17:80964708-80964730 CTGGCGGAGAGGCAGGCGCTGGG + Exonic
1152689426 17:81711357-81711379 CTGGCCCAGGTGCACCTGCTGGG - Intergenic
1152818608 17:82424038-82424060 CAGGCTGAGGGGCACCAGCAAGG - Intronic
1152887950 17:82863583-82863605 CTGGTTGAGGGGTTAGTGCTCGG + Intronic
1155983164 18:32202134-32202156 ATGGCAGAGGGGAAAGTGCTTGG - Intronic
1156462296 18:37327805-37327827 CTGGGTGAGGGGGCCCTGCTGGG - Intronic
1157484893 18:48079860-48079882 CTGGCTGAGGTGCCAGTGCTCGG - Intronic
1157727325 18:49974742-49974764 CTGGCAGCAGGGCATGTGCTGGG - Intronic
1161614724 19:5263735-5263757 CAGGCTGAGAGGCGCGTGCGCGG + Intronic
1165843802 19:38805428-38805450 CAGGCAGAGGGGCAGGGGCTGGG - Intronic
1166220824 19:41363497-41363519 ATGGCTGAGGTGCACGTGATCGG - Exonic
1166368987 19:42291143-42291165 CGGGCTCAGGAGCAGGTGCTGGG + Exonic
1166720663 19:44994157-44994179 CTGCCTGAGTGGCACCTGGTTGG + Intergenic
1167339142 19:48904476-48904498 CTGTGGGAGGGGTACGTGCTGGG + Intronic
1167429816 19:49447808-49447830 CCGGGTGAGGGGCAGGTCCTGGG - Exonic
1168276806 19:55283493-55283515 CAGGTGGAGGGACACGTGCTGGG - Intronic
925428728 2:3772825-3772847 CTGGCTTATGGGCAGGTGTTGGG + Intronic
926054376 2:9765773-9765795 CTTGCAGAGGGTCACATGCTGGG + Intergenic
926152871 2:10434564-10434586 CTGGCTCAGGGACAGGTGCCAGG + Intergenic
927178073 2:20424355-20424377 CTGGCTGAGAAGCTGGTGCTTGG + Intergenic
929091477 2:38221879-38221901 CTGGCTCAGGGGCAGGCCCTTGG + Intergenic
929916344 2:46139080-46139102 CAGGCTGAGGGGGAAATGCTAGG + Intronic
930216337 2:48701125-48701147 GGGGCTGAGGGGCAGGAGCTAGG + Intronic
931450298 2:62362634-62362656 CTGGCTGAGGGCCAGGTGATGGG + Intergenic
931775796 2:65539400-65539422 CTGGCTGAGGTGCGAGTTCTGGG + Intergenic
932599236 2:73112669-73112691 CGGGCTGCGGGGCAAGAGCTCGG - Exonic
933747820 2:85583773-85583795 CTGACTGAGGAGCAAGTGCATGG + Intergenic
936566811 2:113588595-113588617 CTGGATGAGGGGCACGGCATAGG - Intergenic
938277294 2:130037885-130037907 GGGGCTGAGGGGCAGGTGTTGGG - Intergenic
938425217 2:131181173-131181195 CTGGCTGAGGGGCTGGGCCTGGG - Intronic
938438090 2:131299493-131299515 GGGGCTGAGGGGCAGGTGTTGGG + Intronic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
946828187 2:223700706-223700728 CCAGCTGAGGGGAACGTGCCAGG + Intergenic
948319695 2:237059648-237059670 CTGGCTCTGAGCCACGTGCTAGG + Intergenic
1170552825 20:17491759-17491781 CAGGCTGAGGTGCACCTGCCAGG + Intergenic
1171206726 20:23287506-23287528 CTGTCTCAGGGGCACCTTCTGGG - Intergenic
1176188294 20:63793477-63793499 CTGGCTCCGGGCCACGTGATGGG + Intronic
1176386163 21:6139410-6139432 CTGGCTGAGGGTCACCTGCAGGG + Intergenic
1179737310 21:43398842-43398864 CTGGCTGAGGGTCACCTGCAGGG - Intergenic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180466379 22:15615326-15615348 CTGGCTGAGGGGCTGGGCCTGGG - Intergenic
1180791783 22:18578615-18578637 CTGGCTGAGCGCAGCGTGCTGGG - Intergenic
1180844225 22:18972692-18972714 CTGGCAGAGGGGCACGTGCAGGG + Intergenic
1181057247 22:20266019-20266041 CTGGCAGAGGGGCACGTGCAGGG - Intronic
1181229953 22:21416694-21416716 CTGGCTGAGCGCAGCGTGCTGGG + Intergenic
1181248696 22:21518172-21518194 CTGGCTGAGCGCAGCGTGCTGGG - Intergenic
1181939423 22:26463942-26463964 CTGGCTGAGGAGCCGCTGCTGGG - Exonic
1182472538 22:30557337-30557359 ATGGCTAAGGGGCTGGTGCTGGG - Exonic
1184532043 22:45062236-45062258 CTGGCTGTGGGGCTGGGGCTGGG + Intergenic
1184548832 22:45192933-45192955 CCGGGTGATGGGCACCTGCTGGG - Intronic
1184659143 22:45957902-45957924 CTGGCTGATGGGCACAGGCTGGG - Intronic
1185056061 22:48578884-48578906 CTGGCTGATGGGCTCGGCCTGGG + Intronic
1185250378 22:49798740-49798762 GTGGCTGTGGGGCGCGTGGTGGG - Intronic
1185284667 22:49994927-49994949 CTGCCTGGGGGCCACCTGCTGGG - Exonic
1185384273 22:50524665-50524687 CTTGCTGAGGTGCAGGTGCAGGG - Intronic
949982074 3:9508267-9508289 CTGGAAGAGGAGCACGTGTTGGG - Intronic
950007130 3:9698572-9698594 CTGGATGAATGGCACATGCTGGG + Intronic
950662163 3:14473299-14473321 CTGCCTGAGGGGCTCATGCTGGG - Intronic
951073505 3:18361487-18361509 CTGGCTTAGGGGAAGATGCTTGG - Intronic
953463921 3:43103433-43103455 CTGGGTGAGGGGGCAGTGCTGGG - Intronic
953674864 3:44993078-44993100 CTGGCTGAGGGGCTGGGGGTGGG + Intronic
955364538 3:58299833-58299855 CTGGCAGAGGGGTGGGTGCTGGG + Intergenic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
960847131 3:122014859-122014881 CTGGTTGAGGGGCAGATGCTTGG + Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
968488621 4:877499-877521 CTTGCTGAGGCGGACGTGTTTGG - Intronic
968703507 4:2067503-2067525 CTGGCTGTGTGGCAGGTGCTGGG + Exonic
969374248 4:6752911-6752933 CTGGCTGTGTGGCCCGAGCTTGG - Intergenic
973982583 4:56318399-56318421 CTGGATGAGGGGCCCGTTTTTGG + Intronic
975125917 4:70781818-70781840 CTGGCTGAGAGGAGCCTGCTTGG + Intronic
981042667 4:140237785-140237807 CTGGCTGCGGAGCGTGTGCTGGG - Intergenic
982129726 4:152217559-152217581 CTGGTGGAGGAGCACATGCTAGG - Intergenic
985489542 5:171334-171356 CTGGCCCAGGGGCAGGAGCTGGG + Exonic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985768567 5:1795074-1795096 CTGGCTGAGGGTCACCAGCAGGG - Intergenic
985840369 5:2301105-2301127 CTGGATGGCGGGCACGTGCTTGG - Intergenic
985958803 5:3284063-3284085 CTGGCTGGGGGACACGCGTTGGG + Intergenic
986181220 5:5394699-5394721 GTGGGTGAGGGACACGTGGTAGG - Intergenic
986359415 5:6961975-6961997 CTGGCTGAGGACCATGGGCTGGG - Intergenic
986728692 5:10618982-10619004 TGGGCTGAGGGCCACATGCTTGG - Intronic
987343768 5:16960928-16960950 CTGGCTGAAGGGAATGTGCTGGG + Intergenic
987706904 5:21469809-21469831 GTGGGTGAGGGACACGTGGTAGG + Intergenic
994096682 5:95853625-95853647 CTGGCTGGGGGGCTCGTACCAGG + Intronic
995146083 5:108787926-108787948 CTGGATGTGGGACAAGTGCTTGG + Intronic
997206220 5:132051698-132051720 CTGGCTCAGAGGCACGTGGTTGG + Intergenic
997865904 5:137462479-137462501 CTGGCTAAGGGGCAGGTTCGTGG + Intronic
998394074 5:141806908-141806930 CTGGCTGAGGGGGACAAGCAGGG + Intergenic
998950786 5:147391394-147391416 CTCTCTGAGGGCCACGGGCTTGG - Exonic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001913647 5:175541594-175541616 CTGGCTGAGGGGGGCTTCCTGGG - Intergenic
1005046782 6:21650771-21650793 CTGCCTCAGGGAAACGTGCTCGG - Intergenic
1006439150 6:34042586-34042608 CTAGCTGAGAGGCACGGGCTAGG - Intronic
1008518966 6:52344780-52344802 CTGGCCTGGGGGCAAGTGCTGGG + Intergenic
1009021318 6:57950690-57950712 GTGGGTGAGGGACACGTGGTAGG - Intergenic
1013040926 6:106432691-106432713 CAGGCGGAGGTGCACGTGGTGGG - Intergenic
1015925737 6:138308644-138308666 CTGTCTCAGTGGAACGTGCTGGG + Intronic
1017131309 6:151110550-151110572 CTGGCTGAGAGGAAGGGGCTTGG + Intergenic
1018913869 6:168120959-168120981 CTGCCTGAGGTGCTGGTGCTGGG + Intergenic
1019994879 7:4717515-4717537 CTGGCTGGGAGGCACGTGGCTGG + Intronic
1020002809 7:4765345-4765367 CTGGCTGGGAGGCGCTTGCTGGG - Exonic
1023879686 7:44311548-44311570 CAGCCTCAGGGGCACATGCTGGG - Intronic
1025943841 7:66091923-66091945 CTGGCAGAGGGGCAGGTCCTGGG + Intronic
1026944324 7:74306400-74306422 CTCCCGGAGGGGCAGGTGCTTGG - Intronic
1029491057 7:100870362-100870384 CTGGCTCAGGGGCACCTGGAAGG - Exonic
1032197890 7:129799730-129799752 CTGGATGGGGGGCAGGTGGTAGG + Intergenic
1033652980 7:143355998-143356020 CTGCCTGAAGGGCACGTCCATGG - Exonic
1034431809 7:151044912-151044934 AAGGCTGAGGGGCTCGTGCAGGG + Intronic
1035226687 7:157437832-157437854 CTGGGTGGGGGTAACGTGCTAGG - Intergenic
1037403842 8:18521165-18521187 CTTACTAAGGGCCACGTGCTGGG + Intergenic
1037674450 8:21041803-21041825 CTGGCTGAGGGTCATGGGCCAGG - Intergenic
1039966759 8:42289602-42289624 CTGGCAGAGGAGCCCCTGCTTGG - Intronic
1045546981 8:103138485-103138507 CTGGCTGAGGAGCATGTGCCTGG - Intronic
1046519413 8:115305036-115305058 CTGGCCCAGGGGCACATGCTGGG + Intergenic
1049242805 8:141546998-141547020 CTGGCTGAGGGCCACTGCCTAGG + Intergenic
1049249931 8:141582844-141582866 GAGGCTGAGGGGCACAGGCTGGG + Intergenic
1049541194 8:143209971-143209993 CTGACTGAGGGGCAAGTGTAGGG - Intergenic
1049781533 8:144431212-144431234 CTGGGTGTGGTGCACCTGCTGGG - Intronic
1049986951 9:960662-960684 CTGGCTGAGGGGTACGAGCTGGG + Intronic
1057275772 9:93675358-93675380 GTGGCTGAGGGACACCTGCTGGG + Intronic
1057891105 9:98870520-98870542 AGGGCTGATGGGCATGTGCTAGG - Intergenic
1057951922 9:99376032-99376054 GTGGCTGAGGAACACTTGCTGGG + Intergenic
1058704657 9:107628355-107628377 GTGGCAGAGGTGCATGTGCTGGG + Intergenic
1060898938 9:127240440-127240462 CTGGCTGAGGGCCACAGGGTGGG - Intronic
1061363719 9:130159366-130159388 CTGGCTGTGGGGCCGGGGCTGGG - Intergenic
1061370385 9:130194368-130194390 CTGGCTGTGGGGTACGAGCCTGG + Intronic
1062561106 9:137142402-137142424 CTGGGCTGGGGGCACGTGCTGGG - Intronic
1062586350 9:137251615-137251637 CAGGCTGTGGGGCACGTGGCTGG + Intronic
1185578595 X:1193159-1193181 CAGGCAGAGGGGCACCTGCTTGG + Intronic
1185700387 X:2227088-2227110 CTGGCTGGGGTGCAGGTGCAGGG - Intronic
1186137374 X:6533988-6534010 CTGACTCAGGGGGTCGTGCTGGG + Exonic
1186267058 X:7843691-7843713 CTGACTCAGGGGGTCGTGCTGGG - Exonic
1186298048 X:8170134-8170156 CTGACTCAGGGGGTCGTGCTGGG + Exonic
1186324749 X:8465938-8465960 CTGACTCAGGGGGTCGTGCTGGG - Exonic
1189747856 X:44188630-44188652 CTGGATGAGGGGTACTTTCTCGG - Intronic
1190567304 X:51743742-51743764 CGAGCTGAGGGGCTCGCGCTGGG - Exonic
1200157408 X:153984545-153984567 CTGGGGGTGGGGCACGTGGTTGG + Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic
1201438720 Y:13985931-13985953 CTGACTCAGGGGGTCGTGCTGGG + Exonic
1201445853 Y:14056777-14056799 CTGACTCAGGGGGTCGTGCTGGG - Exonic