ID: 944811094

View in Genome Browser
Species Human (GRCh38)
Location 2:203328302-203328324
Sequence GAGGACGGTCACCGCGGCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 43}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944811094 Original CRISPR GAGGACGGTCACCGCGGCGA CGG (reversed) Exonic
903250916 1:22052791-22052813 GAGGACGGAGACGGCGGGGATGG - Exonic
905416463 1:37807923-37807945 GGGGACGGCCACCACGGCGCCGG + Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906310849 1:44753178-44753200 GAGGATGGTCAGCGAGGAGATGG + Exonic
906322540 1:44826225-44826247 GAGCACGGGCACCCCGGGGAGGG - Intronic
1063047317 10:2405445-2405467 GAGGAAGCTCACCGAGGCCATGG - Intergenic
1073136326 10:101222534-101222556 GGGGGGGGTCCCCGCGGCGACGG + Intergenic
1075629343 10:123991777-123991799 GACAGCGGTCCCCGCGGCGACGG + Intergenic
1078094306 11:8287185-8287207 GAGGACAGTCACCACGGGGAGGG - Intergenic
1082023401 11:47553182-47553204 GAGGAGGGGGAGCGCGGCGAGGG + Intronic
1083766665 11:64844692-64844714 GAGGAAGGTGACAGCGGGGAGGG - Intergenic
1093887758 12:24482087-24482109 TAGGATGGTTACCGAGGCGAAGG - Intergenic
1101605890 12:106247634-106247656 AAGGGCGGCCACCGCGGCGGCGG - Exonic
1117478234 14:56118527-56118549 GGGGAAGGGCACGGCGGCGAAGG - Exonic
1121463059 14:94096907-94096929 GTGGAGGCTCACCGAGGCGAAGG + Exonic
1130348050 15:83067054-83067076 GAGGACGGTGAGGGCGGCGGCGG + Exonic
1141663933 16:85456144-85456166 GAGGAGGGTCACCGAGGGGTAGG + Intergenic
1142683289 17:1562475-1562497 GGGGACGGCCGCCGGGGCGACGG - Intronic
1157724417 18:49952923-49952945 GAGGACGGTGAGCGCAGTGATGG - Intronic
1158836090 18:61333487-61333509 GGGGACGGTGACCGCGACCAGGG + Intergenic
1160229052 18:77032617-77032639 GTGGACTGTCACCGCGCTGAAGG - Intronic
925376456 2:3389312-3389334 GAGCACAGTCACCGAGGCCACGG - Intronic
930688083 2:54330566-54330588 GAGGGCGGGCACGGCGGAGACGG + Intronic
932427218 2:71645670-71645692 GAGGACGGTGTCCCTGGCGAGGG - Intronic
941905742 2:170715511-170715533 GAGGACGGCCACCGCGGCCATGG - Exonic
944811094 2:203328302-203328324 GAGGACGGTCACCGCGGCGACGG - Exonic
1174028798 20:47603718-47603740 GAGGACGGTCAGAGAGGAGATGG - Intronic
1176422378 21:6526608-6526630 GAGAACGTTCACCACAGCGATGG - Intergenic
1179697869 21:43134924-43134946 GAGAACGTTCACCACAGCGATGG - Intergenic
1184656578 22:45944813-45944835 GAGGACAGTCAGCGCGGGGGTGG - Intronic
1185059903 22:48600948-48600970 GAGCACCGTGACCGCGGAGAGGG - Intronic
1185298788 22:50068276-50068298 GAGCACGGTCACCGCTGCCCAGG + Intronic
950386477 3:12664147-12664169 GAGGACGAGCACCGAGTCGAGGG - Exonic
950496618 3:13337830-13337852 GAGGACGGGCACCCAGGTGAGGG - Exonic
1002052255 5:176577671-176577693 GTGGATGGTCACCATGGCGACGG - Exonic
1012581994 6:100881008-100881030 GAGAAGGGTCGCCGCGGCCAGGG - Intronic
1019287581 7:231388-231410 GAGGAGGGTCCCGGCGTCGAGGG + Intronic
1019287615 7:231481-231503 GAGGAGGGTCCCGGCGTCGAGGG + Intronic
1034513365 7:151553826-151553848 GCGGACGGTCTTCGCGGCCAGGG - Intergenic
1035153460 7:156893424-156893446 GGGGACGGGGAACGCGGCGAGGG + Intergenic
1049277343 8:141726402-141726424 GAGGACCGTCACCGTGGGTAGGG - Intergenic
1056413431 9:86354383-86354405 GAGGCTGGGGACCGCGGCGAAGG - Exonic
1060968474 9:127724624-127724646 GAGGACGGAGACTGCGGCGGGGG + Intronic
1061710690 9:132485720-132485742 GATGAAGCTCACCGCCGCGATGG - Intronic
1203773809 EBV:62025-62047 CAGGACGGGCACAGCCGCGACGG + Intergenic
1200100211 X:153686417-153686439 GAGGACGGTGACCTGGGGGAGGG - Intronic