ID: 944816260

View in Genome Browser
Species Human (GRCh38)
Location 2:203379007-203379029
Sequence AACTGCAAGCTGCAATTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944816260_944816261 19 Left 944816260 2:203379007-203379029 CCACTAAATTGCAGCTTGCAGTT 0: 1
1: 0
2: 1
3: 14
4: 154
Right 944816261 2:203379049-203379071 GTACTAATTACCTGTGTATGTGG 0: 1
1: 0
2: 0
3: 9
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944816260 Original CRISPR AACTGCAAGCTGCAATTTAG TGG (reversed) Intronic
900624372 1:3601393-3601415 GACTGCAAGCTGCTATTTTGGGG + Intronic
902930658 1:19728995-19729017 AAGTAGAAGCTGCCATTTAGTGG + Intronic
911990532 1:104691638-104691660 TACTGCAATATGCAATTTACTGG - Intergenic
914785016 1:150821400-150821422 TACTGCAATATGCAATTTACTGG + Intronic
916509232 1:165456613-165456635 AACTGGAAACTGACATTTAGAGG - Intergenic
921169171 1:212530810-212530832 AACTTCAAGCACCAATTTTGGGG + Intergenic
921370919 1:214422417-214422439 AGTTGACAGCTGCAATTTAGAGG - Intronic
922858912 1:228798659-228798681 AAAGGCAAGCTCCCATTTAGGGG + Intergenic
1063171070 10:3510461-3510483 ACCTGCCTGCTGCAATTTAAAGG - Intergenic
1063516406 10:6700324-6700346 AAAGGCAAGTAGCAATTTAGCGG + Intergenic
1063913343 10:10854696-10854718 AATTGCAAGTTGGAATTTGGAGG - Intergenic
1067919429 10:50438342-50438364 AAGTGCAGGCTGCCATTTTGTGG + Intronic
1071816405 10:89236398-89236420 TACTGCAATGTGCAATTTACTGG - Intronic
1074921109 10:118013623-118013645 TACTGCAAGATACAATTAAGAGG - Intronic
1080938564 11:36887804-36887826 ATCTGCAAGCTGCAAATTAGGGG + Intergenic
1087161760 11:94955195-94955217 TATTGCAACCTGCAATTTACTGG + Intergenic
1088070088 11:105772160-105772182 TACTGCAATAGGCAATTTAGTGG - Intronic
1088089701 11:106022923-106022945 AACTGCAAACTTGAATATAGAGG - Intergenic
1091011033 11:132000654-132000676 AAATGCAAGATGAAATATAGAGG - Intronic
1091081678 11:132675087-132675109 AACTAGAAGGTGCAATTCAGTGG + Intronic
1094242167 12:28241426-28241448 AACTGCAAGCTGCCACTTGGGGG - Intronic
1097443114 12:59635203-59635225 AACTCCAAGCTGAGATTTATAGG - Intronic
1102781392 12:115568278-115568300 TATTGCAATCTGCAATTTACTGG + Intergenic
1103859603 12:124001752-124001774 GAGTGCAAGCTGCAGTCTAGTGG - Intronic
1108253530 13:48589612-48589634 AACTGGTTGCTGGAATTTAGGGG + Intergenic
1108410274 13:50138856-50138878 AAATTCAGGCTGCATTTTAGGGG + Intronic
1110205362 13:72905719-72905741 AACTGCAAGTTGCAATTTTTTGG - Intronic
1114596670 14:23918110-23918132 AGCTGCCAGCTGCAATTCAGAGG - Intergenic
1114856017 14:26444888-26444910 AACTTCAAGCAGTAATTTTGTGG + Intronic
1115366218 14:32560043-32560065 AATTTCAAGCTGAAATTTGGGGG + Intronic
1118010180 14:61602790-61602812 AACTGCACTCTGCTTTTTAGAGG - Intronic
1121004553 14:90481010-90481032 TACTGCAATATGCAATTTACTGG + Intergenic
1122226200 14:100281579-100281601 AACTCCAAGCTGCACTTTCTTGG + Exonic
1124035057 15:26047038-26047060 CACTGCAAACTGCAATGTAAAGG + Intergenic
1125321890 15:38497889-38497911 ATCTGCAAGCTCCACTTGAGTGG + Intronic
1126364723 15:47882415-47882437 AACTACAAACTTAAATTTAGTGG + Intergenic
1132174332 15:99698110-99698132 AACAGGAAACTGAAATTTAGAGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1139675122 16:68518344-68518366 AACAGAAAGTTGCAATGTAGGGG + Intergenic
1141995023 16:87631084-87631106 AAGTGCAAGCTGCATTTGAGAGG - Intronic
1144811753 17:18004835-18004857 AACTGCAGGCTGCAATGCGGAGG - Intronic
1148516128 17:48219483-48219505 AACTGGATGCTGAAATCTAGAGG - Intronic
1153403233 18:4704911-4704933 AACAGCAGGGAGCAATTTAGTGG + Intergenic
1157907562 18:51583308-51583330 ACCTGCAATCTGTAATATAGGGG - Intergenic
1160336629 18:78047162-78047184 AAATACAGGCTGCAATTTGGGGG + Intergenic
1161672062 19:5618684-5618706 CACTGCAGGCTACTATTTAGGGG - Intronic
1164800875 19:31075520-31075542 AGCTGCAAGCTGCTATTTTTTGG + Intergenic
1166578013 19:43863192-43863214 TACTGCAATATGCAATTTACTGG - Intergenic
1167070047 19:47216277-47216299 AACTGCAAGTGGCAAAATAGTGG - Intergenic
1167884801 19:52492080-52492102 AACTGCAAGCTCCAACTTCCGGG - Intronic
1168566284 19:57426768-57426790 AACAGCAAGCTGGAGCTTAGGGG - Intronic
925602043 2:5617982-5618004 AGCTGCAAGCTTCAATTTCCAGG + Intergenic
928252003 2:29689303-29689325 CACTGCAGGCTGCAAATAAGTGG - Intronic
928778991 2:34797841-34797863 AAATGAAAGCTGCATTTGAGTGG - Intergenic
931176025 2:59856150-59856172 AACTCCAAGGTCCCATTTAGTGG - Intergenic
931343226 2:61422967-61422989 AAATGCAAACTGCAGTTTAATGG - Intronic
932024195 2:68116921-68116943 CTCTGAATGCTGCAATTTAGAGG - Intergenic
935629655 2:105202750-105202772 AACTGCAAGGTGCAATGTTTTGG + Intergenic
936066523 2:109336713-109336735 AACTGCAACATCCAATTTTGTGG + Intronic
936475502 2:112836074-112836096 CACTGAAAGAGGCAATTTAGGGG + Intronic
936927762 2:117755150-117755172 ATCTTAAAGCTGCAATTTAGGGG - Intergenic
937088465 2:119188127-119188149 CACTGCAATATGCAATTTACTGG + Intergenic
937113640 2:119387385-119387407 AACTGCAAGCTACAACTTACCGG - Intergenic
938249762 2:129805538-129805560 CACTGCAAGCTCCAATGCAGGGG + Intergenic
939627733 2:144498711-144498733 AAATGAAAAGTGCAATTTAGAGG - Intronic
940734410 2:157432925-157432947 ACCTACATGCTGCCATTTAGAGG + Intronic
941627244 2:167843722-167843744 AATTGAAACCTGCAATTTATGGG - Intergenic
942245847 2:174007236-174007258 TACTGCAATATGCAATTTACTGG - Intergenic
943779530 2:191806775-191806797 AAGTACAAGATGCAATTTAGTGG + Intergenic
944816260 2:203379007-203379029 AACTGCAAGCTGCAATTTAGTGG - Intronic
945501636 2:210582910-210582932 AACTTCATGCCCCAATTTAGAGG + Intronic
945625344 2:212197825-212197847 AATTGCAAGTTAGAATTTAGAGG - Intronic
1170702666 20:18717160-18717182 TACTGCAATCTGCAATTTACTGG + Intronic
1171737295 20:28806579-28806601 AACTGCAAGTTGATATTTGGGGG - Intergenic
1173745230 20:45431653-45431675 AACTTCAGACTGCAATTTGGGGG - Intergenic
1178119579 21:29454930-29454952 AACTACATGATGCAATTTAATGG + Intronic
1181712532 22:24699630-24699652 AATTGAAAACTGAAATTTAGAGG + Intergenic
1182009181 22:26986183-26986205 AACTTCAAGCAGCAATTTGTCGG - Intergenic
1182183908 22:28381608-28381630 AACTGCAAACTGCAAATTACAGG + Intronic
1182324767 22:29504198-29504220 AAGTGCAGGCTGCAATGCAGGGG + Intergenic
1183563328 22:38594208-38594230 AGCAGCAAGCAGCAATGTAGTGG - Intronic
949361437 3:3236280-3236302 AACTGGAAGCTGCAGTTTTAGGG + Intergenic
949710428 3:6864135-6864157 AGCTGCAATTTGCAAATTAGAGG - Intronic
950952543 3:17015845-17015867 GTCTGAAAGCTGTAATTTAGAGG + Intronic
951061546 3:18213331-18213353 AAATGAAAGCAGAAATTTAGTGG + Intronic
953384490 3:42498919-42498941 AACTCCAGGCTGTAATTTGGTGG - Intronic
956313684 3:67910637-67910659 TACTGCAATATGCAATTTACTGG - Intergenic
957261549 3:77908477-77908499 AACTGGAAGATGCAATTCAAAGG + Intergenic
958207867 3:90428290-90428312 ATCTGCAAGCTGACATTTGGAGG - Intergenic
958720355 3:97836301-97836323 AACTAAAAGCTGCAATTTTAAGG - Intronic
958755867 3:98248566-98248588 ATCTGCAAGCTGGATTTTGGGGG - Intergenic
959410826 3:106019016-106019038 AACTGCAACATGCGATTAAGAGG - Intergenic
962625108 3:137218328-137218350 AAATGGAAGCTGCAATCTAGGGG - Intergenic
964297463 3:155249802-155249824 TACTGCAATATGCAATTTACTGG + Intergenic
970048228 4:11880567-11880589 AACTGCTAGCTGAAATCTGGAGG + Intergenic
971732450 4:30403062-30403084 TACTGCAACATGCAATTTACTGG - Intergenic
972339340 4:38137479-38137501 AACTCCAACTTGCAATTCAGGGG + Exonic
972950787 4:44319774-44319796 AACTGGAAGTTGCAAATTATAGG + Intronic
974653390 4:64785196-64785218 AAATGCAAGCTGTCATTGAGAGG - Intergenic
975056977 4:69945822-69945844 AATTGGAAGCTCCAATGTAGTGG - Intronic
976688179 4:87839164-87839186 AGAAGCAAGCTGCAATTTGGTGG - Intronic
978008472 4:103649770-103649792 AATTCCAAACTGCAATTTTGAGG - Intronic
979650846 4:123129360-123129382 AAATGATAGCTGCAATTTATGGG - Intronic
980230533 4:130040787-130040809 AACTGCAAACTGCAAACTGGTGG + Intergenic
980715122 4:136617637-136617659 ATCTGCAAGCTGGATTTTGGGGG - Intergenic
981043212 4:140242247-140242269 TGCTGCAAGCTGCAATATAATGG - Intergenic
981120090 4:141039741-141039763 AACTGCAAGCTCCTATTTCAGGG + Intronic
982513773 4:156318597-156318619 AGATGCAAGATGCAATGTAGTGG + Intergenic
983425486 4:167578852-167578874 AACTGCAAGATGCAAATAAAAGG + Intergenic
991149245 5:63347224-63347246 AACTGCAACATGAATTTTAGTGG - Intergenic
991735188 5:69625257-69625279 AACTGTATGCTTCCATTTAGAGG - Intergenic
991779790 5:70121462-70121484 AACTGTATGCTTCCATTTAGAGG + Intergenic
991811622 5:70480393-70480415 AACTGTATGCTTCCATTTAGAGG - Intergenic
991859077 5:70996891-70996913 AACTGTATGCTTCCATTTAGAGG + Intronic
991872237 5:71121783-71121805 AACTGTATGCTTCCATTTAGAGG + Intergenic
992046706 5:72899008-72899030 AACTGCATTCTGCAATTCAAAGG - Intronic
995981964 5:118114981-118115003 AACTGCATTCCGCAGTTTAGTGG + Intergenic
997158308 5:131580884-131580906 ATCTGCAAGCTGGATTTTGGGGG - Intronic
998689870 5:144575587-144575609 AACTGCAGGCAGCAATTTTGAGG - Intergenic
999896125 5:156035568-156035590 AACTCCAAGCTGGAGTTCAGTGG - Intronic
999924797 5:156363228-156363250 AACTGAAATCTGACATTTAGAGG - Intronic
1001655619 5:173346904-173346926 TACTGCAATATGCAATTTACTGG + Intergenic
1004134154 6:12950515-12950537 AAATGCAATCTGCAACTTAGAGG + Intronic
1006549584 6:34810309-34810331 TACTGCAATATGCAATTTATTGG + Intronic
1009463288 6:63940059-63940081 TACTGCAATATGCAATTTACTGG - Intronic
1010476221 6:76291547-76291569 CAATGCAAGCTGCAACTTGGAGG + Intergenic
1013005794 6:106072394-106072416 AATTGCATGCTGCACTTCAGTGG - Intergenic
1013458039 6:110349775-110349797 AACTGCCAGCTCTAATTTATTGG + Intronic
1014490298 6:122054238-122054260 ACCTATCAGCTGCAATTTAGGGG + Intergenic
1015012647 6:128370055-128370077 AAATGAAAGCTGCATTTCAGAGG + Intronic
1015188213 6:130443222-130443244 AAATGCAAGGTGGAATTTTGGGG - Intergenic
1015471236 6:133608916-133608938 TACTGCAAAATGCAATTTACTGG + Intergenic
1016180577 6:141142724-141142746 TACTGCAATCTGCAATTTACTGG + Intergenic
1016844512 6:148557753-148557775 AACTGGAAGCTGTTATTGAGAGG - Intergenic
1021362200 7:19729487-19729509 AACTACAAGCTAAAATCTAGGGG - Intronic
1022385582 7:29895859-29895881 AACTGTAATCCCCAATTTAGAGG - Intronic
1022478155 7:30725426-30725448 ACCTGCAGGCTGCATTCTAGTGG + Intronic
1027571775 7:79877117-79877139 AACTGCATTGTGCAATTTACTGG + Intergenic
1027934350 7:84584564-84584586 AGCAGCAAGCTGAAGTTTAGAGG + Intergenic
1030995620 7:116355310-116355332 AACTTCATGCTGCAAATCAGAGG + Intronic
1031106946 7:117555490-117555512 TACTGCAATATGCAATTTACTGG - Intronic
1031627476 7:124007410-124007432 TCCTGCAAGCTGCAATTAGGTGG + Intergenic
1032978509 7:137253463-137253485 AACTGGAAGAAGCAATTTGGCGG - Exonic
1035678930 8:1473451-1473473 AACTGCAAGCAGCCATTTTCTGG - Intergenic
1038586289 8:28791898-28791920 TACTGCAAACTGTAATTTATAGG + Intronic
1042776916 8:72442131-72442153 TGCTGCAACCTGCTATTTAGTGG - Intergenic
1044362102 8:91298229-91298251 AAATACAAGCTACACTTTAGTGG - Intronic
1045981625 8:108196265-108196287 TACTGCAATATGCAATTTATTGG - Intergenic
1047810296 8:128401500-128401522 AACTGTAAGCTTTAATTCAGAGG + Intergenic
1048169282 8:132090022-132090044 AAATGCAATGTGGAATTTAGTGG + Intronic
1048551375 8:135436590-135436612 AACTGCTAGCCTCATTTTAGGGG + Intergenic
1055623237 9:78147410-78147432 AACTTCAAAATGCAATTTGGAGG + Intergenic
1055856599 9:80695748-80695770 TAATGCAAGTAGCAATTTAGGGG - Intergenic
1056926191 9:90836642-90836664 TACTGCAATATGCAATTTACTGG - Intronic
1058503114 9:105642536-105642558 ATGAGGAAGCTGCAATTTAGAGG + Intergenic
1060901421 9:127261337-127261359 ATCTGCCAGCTGCAATGGAGAGG - Intronic
1061806269 9:133139376-133139398 AACGGCAAGCGGCTATTTCGAGG + Intronic
1187607002 X:20895864-20895886 AACTTCAAGCTATAATATAGTGG + Intergenic
1188632786 X:32388483-32388505 TAATTCAAGCTGCATTTTAGTGG - Intronic
1189569375 X:42279035-42279057 AACTGAAAGGAGCAATTTATTGG + Intergenic
1191570364 X:62607693-62607715 AACTGCAAGTGGACATTTAGAGG + Intergenic
1191586048 X:62827819-62827841 AAATAGAAGCTGCAATTCAGAGG - Intergenic
1192535605 X:71924552-71924574 AACTGGAAGCTAGAAGTTAGAGG + Intergenic
1193896962 X:87126718-87126740 ACCTGCAAGCTGCACTTTCTGGG - Intergenic
1194382926 X:93217601-93217623 GCCTGCAAGCTAGAATTTAGAGG + Intergenic
1195858138 X:109352609-109352631 ATCTGCATGCTGCAGTTTAAGGG - Intergenic
1196095786 X:111798386-111798408 TACTGCAATATGCAATTTATTGG - Intronic
1199341030 X:146677528-146677550 AAGTTCATGCAGCAATTTAGTGG - Intergenic
1200842783 Y:7800409-7800431 ATCTGCAAGTTGCAGTTTAAAGG - Intergenic
1201625001 Y:16005126-16005148 AACAGAAAGCTGAAATTTACTGG - Intergenic