ID: 944817650

View in Genome Browser
Species Human (GRCh38)
Location 2:203394728-203394750
Sequence GGTACCACTGGAGGACGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944817650_944817654 12 Left 944817650 2:203394728-203394750 CCAGTGCGTCCTCCAGTGGTACC 0: 1
1: 0
2: 1
3: 3
4: 62
Right 944817654 2:203394763-203394785 ACCTAGCCCAACCCGTAATATGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944817650 Original CRISPR GGTACCACTGGAGGACGCAC TGG (reversed) Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900372307 1:2337429-2337451 GGTCCCACTGAGGGATGCACAGG - Intronic
901018358 1:6244068-6244090 GGGACCGAGGGAGGACGCACTGG - Intergenic
901093447 1:6659418-6659440 GGTGCCACTGGAGGAAGGATGGG - Intronic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
922571619 1:226637812-226637834 GGGACCACTAGAGGCCGCATGGG - Intronic
1063540892 10:6932754-6932776 GCTCCCAATGGAGGAAGCACTGG - Intergenic
1068117091 10:52747380-52747402 TGTACCACAGGAGGAACCACAGG + Intergenic
1070798506 10:79231018-79231040 GGCACCCCAGGAGGAGGCACAGG - Intronic
1074783935 10:116822202-116822224 ATTACCAGTGGAGGAAGCACAGG + Intergenic
1076414822 10:130278187-130278209 GGTAGCACTGGAGGCAGCAGGGG + Intergenic
1076644549 10:131943647-131943669 GTGGCCACTGGAGGACACACAGG + Intronic
1080669078 11:34359166-34359188 GGTTCCACTGGAGGGGGCACAGG - Intergenic
1083807775 11:65085111-65085133 GGTAGGACTGGACGATGCACTGG - Exonic
1088778614 11:113111519-113111541 TGGACCACAGGAGGACACACAGG + Intronic
1095293042 12:40498243-40498265 GGTACCACTGGGGTAACCACTGG + Intronic
1104126010 12:125846797-125846819 GTTATCACTGGAGGAAGCAGAGG - Intergenic
1104479238 12:129093038-129093060 GGACGCACTGGAGGACACACTGG + Intronic
1104558361 12:129822287-129822309 TGTCTCACTGGAGGACTCACAGG + Intronic
1118040809 14:61914551-61914573 GGGAACACTGGAGGAGGAACAGG - Intergenic
1121751623 14:96362913-96362935 GGTACCTCTGCAGGAGGTACCGG + Exonic
1124624255 15:31299109-31299131 GGCACCACTGGAGGAGGGCCCGG + Intergenic
1131083325 15:89554996-89555018 GGTACCACTGGAGTAGACCCTGG + Intergenic
1133225963 16:4340525-4340547 GGTGCCACTGAAGGAAGCATTGG - Intronic
1133226440 16:4343043-4343065 GGTACCACTGAAGAATGCCCCGG + Intronic
1138661022 16:58516814-58516836 GGAACCACTGGAGGAAGAAGAGG + Exonic
1141684907 16:85564664-85564686 GGTGCCTCTGAAGGACGCACAGG - Intergenic
1143625539 17:8108608-8108630 GGTACCACTGGAGTAACCACGGG + Intronic
1148773432 17:50079760-50079782 GGGACCAAAGGAGGAGGCACTGG + Intronic
1151543919 17:74780388-74780410 GGCTGCACTGGAGGAGGCACAGG - Intronic
1152831598 17:82500728-82500750 GGAAGCACTGGAGGAGGCATGGG - Intergenic
1156256469 18:35402243-35402265 TGGACCACTGGAGGAAGAACAGG + Intergenic
1156904229 18:42335282-42335304 GGTACCACTAAAGGAGGTACAGG + Intergenic
1157633895 18:49130062-49130084 GCTACCACTGGAGAAGGGACAGG + Intronic
1160628730 18:80230747-80230769 GGTAGCAGTGGAGGACACAGAGG + Intronic
1161129556 19:2579910-2579932 GGAACCTCTGGAGGGAGCACAGG - Intronic
1161482623 19:4518450-4518472 GGGTCCCCTGGAGGACGGACCGG + Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
927990436 2:27443220-27443242 GGTACCACTGGATGAGGGGCCGG + Exonic
939633170 2:144550156-144550178 TGTACCACTGGATGGAGCACAGG + Intergenic
940863269 2:158791644-158791666 GCTTCCACTGGAGGAGGCCCAGG - Intergenic
944817650 2:203394728-203394750 GGTACCACTGGAGGACGCACTGG - Exonic
1173079055 20:39848794-39848816 GGTAGCACTGGAGGTGGCAGAGG - Intergenic
1179490056 21:41735389-41735411 GGTACCACTGGAGAATGACCTGG - Intergenic
1185078318 22:48695043-48695065 GGTACCACAGAAGAACCCACAGG - Intronic
1185366802 22:50440569-50440591 GGTCTCACAGGAGGACGCAGAGG - Intronic
950297517 3:11844993-11845015 GGAAGCACTGGGGGAAGCACAGG + Intronic
954147992 3:48643738-48643760 GGGAACACGGGAGGACACACAGG + Intronic
959028684 3:101272194-101272216 GGTATTACTGGAAGACACACAGG - Intronic
960599957 3:119446998-119447020 GGTAAAACTGGAGTACTCACGGG + Exonic
968642070 4:1719972-1719994 GGTACCTCTGGAGGACACGGGGG - Intronic
974401464 4:61413255-61413277 GGTATCAGTGGAGGTCACACAGG - Intronic
982777093 4:159453073-159453095 GGTACCACCGCCGGACGCAGTGG - Intergenic
991049665 5:62259044-62259066 AGGACCACTGGAGGATGAACAGG + Intergenic
997379737 5:133427075-133427097 GTCACCACTGGAGAACACACAGG + Intronic
1006003791 6:30987089-30987111 GGCCCCACTGGAGGTCGTACTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1022628343 7:32061438-32061460 GGCACCTCTGGAGCAGGCACAGG + Intronic
1024076709 7:45824533-45824555 GGTACTACTGGAGGGGGCAGAGG + Intergenic
1024576724 7:50770475-50770497 GCTACCACAGGTGGAAGCACAGG - Intronic
1025127708 7:56356892-56356914 GGTACTACTGGAGGGGGCAGAGG - Intergenic
1033983758 7:147197449-147197471 GTTACCAGTGGAGGATGTACAGG - Intronic
1035625780 8:1069363-1069385 GGTCTCACTGGAGGACGGGCCGG + Intergenic
1036781506 8:11651101-11651123 GGTATCCCTGGGGGACGCAGTGG - Intergenic
1038319030 8:26511942-26511964 GGTAACACTGCAGGTCACACTGG - Intronic
1050290119 9:4145318-4145340 GGTACCTCTGGAGAACACGCTGG + Intronic
1055670440 9:78600261-78600283 GGGACAACTGGAGGAGGCAAGGG - Intergenic