ID: 944821853

View in Genome Browser
Species Human (GRCh38)
Location 2:203440288-203440310
Sequence CAGTAAGACGTCCAGCCCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944821853_944821861 11 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821861 2:203440322-203440344 TGGAGATCCACTTTTGTCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 125
944821853_944821859 9 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821859 2:203440320-203440342 CCTGGAGATCCACTTTTGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 103
944821853_944821862 15 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821862 2:203440326-203440348 GATCCACTTTTGTCAGGGGTAGG 0: 1
1: 0
2: 0
3: 12
4: 150
944821853_944821865 27 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821865 2:203440338-203440360 TCAGGGGTAGGAGAAGCTGTGGG 0: 1
1: 0
2: 1
3: 40
4: 375
944821853_944821864 26 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821864 2:203440337-203440359 GTCAGGGGTAGGAGAAGCTGTGG 0: 1
1: 0
2: 3
3: 40
4: 486
944821853_944821857 -9 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821857 2:203440302-203440324 GTCTTACTGGTCTTTTTGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 131
944821853_944821860 10 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821860 2:203440321-203440343 CTGGAGATCCACTTTTGTCAGGG 0: 1
1: 0
2: 1
3: 8
4: 126
944821853_944821866 30 Left 944821853 2:203440288-203440310 CCCCAGGGCTGGACGTCTTACTG 0: 1
1: 0
2: 0
3: 10
4: 88
Right 944821866 2:203440341-203440363 GGGGTAGGAGAAGCTGTGGGTGG 0: 1
1: 1
2: 4
3: 62
4: 641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944821853 Original CRISPR CAGTAAGACGTCCAGCCCTG GGG (reversed) Exonic
901025514 1:6276957-6276979 CAGGAGGAGGGCCAGCCCTGGGG - Intronic
902216684 1:14938627-14938649 CAATAGGACGTCAAGCACTGGGG + Intronic
902235403 1:15054132-15054154 CAGGAAGAACTCCAGGCCTGGGG + Intronic
902824626 1:18964583-18964605 CAGCCAGAAGTCCTGCCCTGAGG + Intergenic
903006094 1:20299889-20299911 CAGTGAGAGGTAGAGCCCTGGGG + Intronic
903345647 1:22682505-22682527 CAGGAAGACTCTCAGCCCTGGGG + Intergenic
905206157 1:36343963-36343985 CAGAAACCCGTCCATCCCTGAGG + Exonic
915632735 1:157164404-157164426 GAGGAAAACGTCCAGCCCTGGGG + Intergenic
920630006 1:207643079-207643101 CAGTAAAATTTCCATCCCTGGGG - Intergenic
921262922 1:213399755-213399777 CACTAAGATGTCCATCGCTGTGG + Intergenic
922791224 1:228312150-228312172 CAGAAAGAACTCCAGCCATGGGG + Intronic
923126051 1:231035492-231035514 CACAAAGACCTTCAGCCCTGGGG - Intronic
1067175688 10:43943954-43943976 CAGGAAGACGTCCAGGCCTTGGG + Intergenic
1070575310 10:77672930-77672952 CAGCTAGAATTCCAGCCCTGGGG - Intergenic
1070653124 10:78252291-78252313 CAGCAGGACCTCCAGCCCCGGGG - Intergenic
1071269067 10:83990449-83990471 CAGAGAGACGGCCAGCCCTCAGG - Intergenic
1078663949 11:13309230-13309252 GAGGAAGACGTCCAGCTCAGAGG + Intronic
1089260844 11:117223065-117223087 CCTTAAGACATCCAGCTCTGTGG + Intronic
1090119935 11:124015627-124015649 GAGGAGGGCGTCCAGCCCTGGGG - Exonic
1090120580 11:124023065-124023087 GAGTGGGGCGTCCAGCCCTGGGG - Exonic
1090788066 11:130068088-130068110 CAGGAAGAGGTCCATCACTGAGG - Intergenic
1101772816 12:107767237-107767259 CAGTCACAAGTCCAGGCCTGTGG + Intergenic
1102511355 12:113417734-113417756 CAGTGAGAAGTTCAGCCCGGCGG - Intronic
1103461921 12:121111586-121111608 CAGGAGGACTTCCAGTCCTGAGG - Intergenic
1103684776 12:122723346-122723368 CGGTAAGACGTGAAGCCATGAGG - Intergenic
1105704787 13:22962202-22962224 GAGGCAGACTTCCAGCCCTGTGG - Intergenic
1105857752 13:24387360-24387382 GAGGCAGACTTCCAGCCCTGTGG - Intergenic
1106590237 13:31092338-31092360 CAGAAAGCCAGCCAGCCCTGGGG - Intergenic
1112289307 13:98130838-98130860 CAGCAAGACGTCCAGCGAAGGGG + Intergenic
1117226862 14:53670150-53670172 TAGACAGACGTCCAGCCCTGAGG + Intergenic
1124847903 15:33309977-33309999 CATTTAGAGTTCCAGCCCTGTGG - Intergenic
1129447540 15:75629400-75629422 CAGGAAGGTGTCCAGCCCAGAGG + Intergenic
1132570747 16:642852-642874 AAGTCAAACGTCCAGCCCTGCGG - Intronic
1132936841 16:2485612-2485634 CAGTCAGAAGTCCAGGCCTCTGG - Intronic
1135552688 16:23410168-23410190 CAGACAGTCCTCCAGCCCTGTGG + Intronic
1138897796 16:61229722-61229744 CAGAAAGACATCCAGCTTTGAGG - Intergenic
1139289415 16:65844027-65844049 CAGAAAGACTCCCAGCCCAGGGG - Intergenic
1139325937 16:66152595-66152617 CAGAAAGATGTGCAGGCCTGAGG + Intergenic
1142494146 17:297410-297432 CAGTCACACGTCCAGACCTCTGG - Intronic
1152188510 17:78873984-78874006 GGATAAGACGTCCAGGCCTGCGG + Intronic
1152320971 17:79608795-79608817 CAGGAAGGCCTCCAGTCCTGGGG + Intergenic
1159017677 18:63114946-63114968 CAGTCAGAAGTCCAGGCCTTTGG - Intergenic
1162403203 19:10458292-10458314 AGGTGATACGTCCAGCCCTGGGG - Intronic
1166310624 19:41960370-41960392 CAATTAGAATTCCAGCCCTGTGG - Intergenic
1166978222 19:46617458-46617480 CAGTGAGATGTCAGGCCCTGGGG + Intergenic
1168085135 19:54040277-54040299 GAGTAACACGTCCAGCTTTGTGG - Intergenic
928294171 2:30068543-30068565 TAGGAAGAGGTCCAGCCCTGTGG + Intergenic
928703403 2:33922178-33922200 CAGTAAGACTACCATCACTGAGG + Intergenic
928871881 2:35989919-35989941 CTGTAACACATGCAGCCCTGTGG - Intergenic
932625013 2:73290694-73290716 CAGAAACACCTCCAGCCCTTAGG + Intergenic
934537896 2:95151476-95151498 CAGAAAGGTGTGCAGCCCTGTGG + Intronic
938137743 2:128773133-128773155 CAGTAAGACTTTAAGACCTGCGG - Intergenic
942414557 2:175745363-175745385 CAGAAAGGCAGCCAGCCCTGAGG + Intergenic
944821853 2:203440288-203440310 CAGTAAGACGTCCAGCCCTGGGG - Exonic
948233979 2:236373536-236373558 CAGTAAGAGGTCAAGCGCGGTGG - Intronic
1169660743 20:7975812-7975834 CAGGAAGACCTCCAGCACTGGGG + Intergenic
1170673253 20:18454470-18454492 CAGTAAGGCGGCCAACCCAGAGG - Intronic
1173094424 20:40011460-40011482 CAGTCAGTCATCAAGCCCTGTGG + Intergenic
1174446805 20:50596176-50596198 CAGCAGCACGTCCAGCTCTGGGG + Exonic
1175415514 20:58798196-58798218 CAGAAAGACATCCCGCGCTGGGG + Intergenic
950256482 3:11510755-11510777 CAGTCAGACTTCCAGGCTTGGGG + Intronic
950478282 3:13227808-13227830 CAGGAAGACGTCCACACGTGAGG + Intergenic
952931661 3:38365529-38365551 CAGTGTGACCGCCAGCCCTGGGG + Intronic
954098166 3:48347679-48347701 CAGGAAGCCGTCCTGCCCTACGG + Intergenic
954330120 3:49885378-49885400 CAGAGAGAAGTCCAGTCCTGGGG - Intergenic
954495198 3:50952144-50952166 CAGTGAGACAGCCAGCTCTGAGG + Intronic
956248674 3:67212915-67212937 CTGTAAGATGGCCATCCCTGTGG + Intergenic
959933004 3:112003002-112003024 CACTAAGACTCCCAGCCCTAGGG + Intronic
965750789 3:171972992-171973014 CAGTAACACTTCCAGCCCCAGGG - Intergenic
969790262 4:9489504-9489526 CAGTGTGAGGTCCAGTCCTGTGG + Intergenic
970234005 4:13940213-13940235 CAGTAACAAGTCCAGGCCTATGG + Intergenic
971173970 4:24262867-24262889 CAGGAAGTTGTACAGCCCTGAGG - Intergenic
979822404 4:125191125-125191147 CATTAAGTCCTCCAGACCTGAGG + Intergenic
981831536 4:149007391-149007413 AAGTGAGACCTCCAGCCCTCAGG + Intergenic
987257248 5:16168670-16168692 CAGTGAGACCTCCAGCCCCATGG - Intronic
998015873 5:138731837-138731859 CAGTAAGAAGTAGAGTCCTGAGG + Intronic
999373826 5:151072595-151072617 CAGCATGACAGCCAGCCCTGAGG + Intronic
1006471315 6:34230730-34230752 CAGTGAGAGGGCAAGCCCTGAGG + Intergenic
1012734128 6:102917540-102917562 CATTAACACCTCCAGCCCTGTGG - Intergenic
1014716153 6:124866510-124866532 CAGAAAGGAGTTCAGCCCTGTGG - Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1022776763 7:33534777-33534799 CAGTCAGTCGTGCAGCCCTCAGG + Intronic
1023795855 7:43791336-43791358 CAGTGAGAGCTCCAGCCATGAGG + Exonic
1032086599 7:128887012-128887034 CAGTAGGGGCTCCAGCCCTGGGG - Intronic
1034062855 7:148109026-148109048 CAGTAAGACGACAAACCCTGAGG - Intronic
1039467560 8:37795497-37795519 CAGTAAGAAGTGCAGCCCAGGGG - Intronic
1039965400 8:42280330-42280352 CCCTAAGACCTCCAGCCCAGGGG + Intronic
1044303494 8:90611538-90611560 AAGAAAGACGTACAACCCTGTGG - Intergenic
1045503935 8:102765125-102765147 CAGTAATATGCCCAACCCTGGGG - Intergenic
1047406955 8:124593607-124593629 CAGGAAGACGTACAGCGCTTAGG + Intronic
1048519278 8:135138732-135138754 CAGTAAGACCCACAGTCCTGTGG + Intergenic
1048593831 8:135845830-135845852 CAGTAACAGGGCCACCCCTGTGG - Intergenic
1059449510 9:114361703-114361725 CATCAAGACCTCCTGCCCTGAGG - Exonic
1059757816 9:117310259-117310281 AAGTAAGCCTTCCACCCCTGGGG - Intronic
1061551059 9:131334973-131334995 CAGAAGGACTCCCAGCCCTGCGG + Intergenic
1192265458 X:69534299-69534321 AAGTAGGACGCCCAGGCCTGGGG + Intergenic
1193913940 X:87342311-87342333 CAGAAAGAAATACAGCCCTGTGG + Intergenic
1194174375 X:90628865-90628887 GAGTAAGATGCGCAGCCCTGGGG - Intergenic
1200520594 Y:4206558-4206580 GAGTAAGATGTGCAGCCCTGGGG - Intergenic