ID: 944824392

View in Genome Browser
Species Human (GRCh38)
Location 2:203467088-203467110
Sequence GAAAGATATAAACAGCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944824392 Original CRISPR GAAAGATATAAACAGCTTAA GGG Intronic
903095963 1:20973831-20973853 GAAAGTTAAAAACAGCTCATTGG - Intronic
903258532 1:22118616-22118638 GAAAGATGTGAACAGCTGGAAGG - Exonic
905562689 1:38940102-38940124 TGAAGATACAAACAGGTTAAGGG - Intronic
906193897 1:43917067-43917089 ATAAGATATAAACAGCTTTGAGG + Intronic
906796119 1:48697633-48697655 GAAAGATAGAAATAGCATTACGG + Intronic
907136098 1:52141410-52141432 GAAATTCATAAACAACTTAAAGG - Intergenic
907794421 1:57700710-57700732 GAAAGATATAAATATCTTTCAGG - Intronic
908180059 1:61594802-61594824 AAAAAATATAAACACCTTTATGG + Intergenic
908617009 1:65932923-65932945 CAAAAATAAAGACAGCTTAAAGG + Intronic
908748115 1:67395285-67395307 GAAAGAAAGAAACAGGTTGAAGG + Intronic
908926760 1:69265023-69265045 GAAAGACATAAACACATGAAAGG - Intergenic
908979108 1:69932678-69932700 GAAAGATGAAAACAACCTAAAGG - Intronic
910483596 1:87685272-87685294 AAAAGACAGAAAAAGCTTAAGGG + Intergenic
910598319 1:89004247-89004269 CAATGAAATAGACAGCTTAAAGG - Intergenic
910966394 1:92812140-92812162 GAAAGATACAAATATCTTACAGG - Intergenic
912353403 1:109036029-109036051 GAAAAATATATACATATTAAAGG + Intronic
913215485 1:116616559-116616581 TAATAATATAAACAGCTTACTGG + Intronic
914736534 1:150422803-150422825 GAAATCAATAAACACCTTAAAGG - Intronic
916409607 1:164532782-164532804 GAAAAAAATAAAAAGCTCAATGG - Intergenic
917021665 1:170594892-170594914 GAAAAAGATAAACAGGTAAAGGG - Intergenic
918590401 1:186234682-186234704 GGAAGAAATAAACTGCTAAATGG + Intergenic
918831367 1:189403500-189403522 GAAAGTGATAATCATCTTAATGG - Intergenic
918865440 1:189892056-189892078 GAAATAGATAATAAGCTTAAGGG + Intergenic
919191590 1:194228071-194228093 GCAAGATATACACAGCTTAATGG - Intergenic
919210154 1:194472030-194472052 GAAAGGTAGAAACATCATAAAGG + Intergenic
919256082 1:195127301-195127323 GAAAGATATTAACACCTGACAGG - Intergenic
919539542 1:198830278-198830300 AAAAGAGAAAAACAGTTTAAGGG + Intergenic
920730947 1:208483886-208483908 GAGAGATACAAACAGCTGGATGG - Intergenic
920879095 1:209863720-209863742 TAAACAGATAAACAGGTTAATGG + Intergenic
920935749 1:210432835-210432857 GAAAGATAAAATAAGCATAAGGG + Intronic
921435536 1:215115791-215115813 GAAAGATAGACAAAGATTAATGG + Intronic
923060503 1:230468036-230468058 GAAAGATATAAATACGTAAAAGG - Intergenic
923121972 1:231000489-231000511 AAAAGATATAAACATGTCAAAGG - Exonic
923142196 1:231169967-231169989 GAAAGAAAAAAACATTTTAAAGG - Intronic
923221147 1:231894807-231894829 GAAAGAAACAAACAGATCAATGG - Intronic
923821558 1:237448840-237448862 TAAAGATACAAAGAGGTTAAAGG - Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1064008449 10:11715964-11715986 GAAAGAGAGAAACAGCAAAACGG + Intergenic
1065224467 10:23528991-23529013 GATATATAGAAAAAGCTTAAGGG - Intergenic
1066298549 10:34076836-34076858 GACAAACACAAACAGCTTAAAGG + Intergenic
1066429665 10:35339257-35339279 GAGAGATTTAAACATATTAATGG - Intronic
1066551598 10:36564378-36564400 GTAAGACATAAGCAACTTAATGG + Intergenic
1068245046 10:54354407-54354429 GAAAGAGATAAGGAGATTAAAGG - Intronic
1068275791 10:54794086-54794108 GAAAGAAATATATATCTTAAAGG - Intronic
1068663117 10:59644637-59644659 AAAAGATATAGACGGCTAAATGG - Intergenic
1068716523 10:60195082-60195104 CAAAGATGTAAAAAGCATAAGGG + Intronic
1068957568 10:62832708-62832730 TAAAGATAGAATCAGCTTCAAGG + Intronic
1068958048 10:62838358-62838380 GAAATCTAAAAACAACTTAAAGG + Intronic
1069722985 10:70561417-70561439 GAAGGATAGAAGCAGCCTAAGGG + Intronic
1070120113 10:73567816-73567838 GAAAGATATAAAGATTATAAAGG - Intronic
1070276035 10:75007683-75007705 AAAACAAATACACAGCTTAATGG - Intronic
1070543856 10:77437512-77437534 GAAAGATATAAAAACATTCATGG + Intronic
1071083972 10:81846515-81846537 AAAAGATATAAAGAGCATTAAGG - Intergenic
1071503562 10:86219693-86219715 GAAAGATATAAAGAACAGAAAGG - Intronic
1071708475 10:88025448-88025470 GAATGATATAAATAACTTGATGG + Intergenic
1073636834 10:105207860-105207882 GAATGAAAGAAACATCTTAATGG - Intronic
1073739357 10:106388896-106388918 GAAAGGGATAAACAGATTAATGG + Intergenic
1073929619 10:108559817-108559839 GAAAGATATAAACAGGTGCTTGG - Intergenic
1074036648 10:109745869-109745891 GAAAGAAAGAAACAGAGTAAAGG - Intergenic
1075565795 10:123503253-123503275 AAAAGATATAAAACTCTTAAAGG - Intergenic
1075950801 10:126476102-126476124 GGAAGATATAAATATCTTAGAGG + Intronic
1075968836 10:126635834-126635856 TAAAAATATAAACTGCTTTAGGG + Intronic
1077739007 11:4824179-4824201 TAAATATTTAAACAGGTTAAGGG + Intronic
1078971168 11:16413408-16413430 GTAATATAAAAACTGCTTAAAGG + Intronic
1079382099 11:19947334-19947356 GGAAAACAAAAACAGCTTAAGGG + Intronic
1079757076 11:24277889-24277911 AGAAGAAATAAACATCTTAATGG + Intergenic
1080037503 11:27723980-27724002 GAAAGTTATTAACAGCATTATGG - Intergenic
1080326859 11:31085011-31085033 GAAAGTTATAGATAGCTTGATGG - Intronic
1080532488 11:33190403-33190425 CAAAGATACAAACCTCTTAATGG - Intergenic
1081420377 11:42868852-42868874 TAAAGTTATAAATACCTTAAAGG - Intergenic
1082619422 11:55401596-55401618 GACAGAAATAAAAAACTTAATGG - Intergenic
1082758559 11:57103229-57103251 GAAAGATATGAACAGTTGACAGG + Intergenic
1082953653 11:58845835-58845857 AGAAGATATAAACTGCCTAAGGG - Intronic
1084053825 11:66618109-66618131 GTAAAAGATAAAGAGCTTAAGGG - Intronic
1085680587 11:78571054-78571076 GAAAGAGCAGAACAGCTTAAGGG + Intronic
1085736660 11:79045080-79045102 GAAAGAGAATAACTGCTTAATGG - Intronic
1086388837 11:86339574-86339596 GAAAGATATAAAAAGTTAGAAGG - Intronic
1088376876 11:109150935-109150957 GTAAGATAAAAACAGCCCAAGGG - Intergenic
1090165155 11:124538670-124538692 AAAAGAAATAAACAGATTTATGG + Intergenic
1090180865 11:124698232-124698254 ACAAGATATAAACAGATTATTGG - Intergenic
1090402432 11:126457862-126457884 GAAAGATGGAAACAGCTCGAGGG + Intronic
1090561784 11:127940470-127940492 GAAAGATATTAATACATTAATGG - Intergenic
1092560006 12:9602820-9602842 GAAACATATAAAGAGACTAAAGG - Intronic
1093544026 12:20323810-20323832 GAAAAATTTAAAAAGTTTAATGG - Intergenic
1094373391 12:29763531-29763553 GAAACATATAATCAGCCTCAAGG + Intronic
1094637816 12:32243737-32243759 GAAAGATATTCTCTGCTTAAAGG - Intronic
1094768484 12:33625276-33625298 GAGAGATATAAACAGCACTATGG + Intergenic
1094770928 12:33659009-33659031 TAAAGATCTAAACATCTCAAAGG + Intergenic
1094817872 12:34204856-34204878 CAAAGATACAGACAGCTTGAAGG - Intergenic
1095519032 12:43039631-43039653 GAAATATATCAAAATCTTAATGG - Intergenic
1096023179 12:48339009-48339031 GAAAGGAATAAACAACTCAAAGG - Exonic
1096339233 12:50783289-50783311 GAAGGATATATCAAGCTTAAAGG - Intronic
1100368985 12:93947763-93947785 AAAAGAATTAAACAGCTGAAGGG - Intergenic
1100463370 12:94822797-94822819 AAAATATATAAACAGCTGAGTGG + Intergenic
1101307207 12:103540494-103540516 GAAAAATATAAACATTCTAAAGG - Intergenic
1101414859 12:104500010-104500032 GAAAAATAGAAGGAGCTTAAGGG - Intronic
1101609005 12:106273380-106273402 GAAGAATAAAAACAGCTTATAGG + Intronic
1101613971 12:106318199-106318221 GAAAAATATTAAAAGATTAATGG + Intronic
1102322589 12:111950291-111950313 GAAAGATGTCCACAGCATAAAGG - Intronic
1103198008 12:119062615-119062637 GAAAGTTTAAAACAGTTTAAAGG - Intronic
1104100684 12:125606028-125606050 GAGAGATATGAAAAGCTGAAGGG + Intronic
1105219223 13:18310036-18310058 TAATAATATAAACAGCTTACTGG + Intergenic
1105518994 13:21114666-21114688 GAAAGATTGCAACACCTTAAAGG - Intergenic
1105981820 13:25524768-25524790 AAAAGATATATATAGCTGAATGG - Intronic
1109076250 13:57839742-57839764 GAGAGATGTATACAGATTAAAGG - Intergenic
1109126415 13:58524012-58524034 TAAATATATAAACAGGATAAAGG + Intergenic
1109439132 13:62346073-62346095 AAAAGAATAAAACAGCTTAACGG + Intergenic
1110324851 13:74202123-74202145 GAAAGATCTTAAGATCTTAAAGG + Intergenic
1110972992 13:81790265-81790287 GGAAGATTTAAACAGCTTGGGGG - Intergenic
1110973212 13:81794091-81794113 ATAAGATATGAAAAGCTTAAAGG + Intergenic
1111416047 13:87945711-87945733 GAAATGTATAAAGAACTTAAAGG - Intergenic
1111603026 13:90498319-90498341 GAAATATATAAATAATTTAAAGG + Intergenic
1113041834 13:106111893-106111915 GAAAAATAGAGAAAGCTTAATGG + Intergenic
1114512508 14:23274573-23274595 GAAAGATAGAAAAAGCTACAAGG + Exonic
1116010367 14:39344473-39344495 GAAAGATACAAATAGTTTGAAGG - Intronic
1116115017 14:40636552-40636574 GATATATATAAACAGAATAAAGG + Intergenic
1117381599 14:55169487-55169509 GAAAGGTTTAAACAGTTTGAAGG - Exonic
1117510952 14:56449991-56450013 AAAAGCTATAAACAGCTTAAAGG - Intergenic
1117952765 14:61099272-61099294 GAAAGATAAAAAAAGTTAAAGGG - Intergenic
1118158027 14:63259975-63259997 AACAGAGAAAAACAGCTTAATGG + Intronic
1118446317 14:65854334-65854356 GGAAGAAATAAACAGCCTCATGG - Intergenic
1118723498 14:68610158-68610180 GAAAGAGACAAACAGCCTCAAGG - Intronic
1118940683 14:70333558-70333580 GAAAGTAATAAACAGCTCACAGG + Intronic
1119811008 14:77519393-77519415 AAATGCTGTAAACAGCTTAAAGG - Intronic
1121768916 14:96513966-96513988 GAAATATTTAAAAAGCATAAAGG - Intronic
1122495388 14:102150546-102150568 TAAAGAAAAAAACAGCTTCATGG - Intronic
1123963777 15:25435840-25435862 AAAAGAAATAAACAACATAAAGG + Intronic
1124068079 15:26364525-26364547 GAAGAATATTAAAAGCTTAATGG + Intergenic
1124473339 15:30008393-30008415 GAAAGAAATAAACAGCTGTCAGG - Intergenic
1124684736 15:31772296-31772318 GAGGGATATAAACAGTTTACAGG - Intronic
1125875943 15:43144759-43144781 GAAAGATACAAACAGTTAACAGG - Intronic
1126243024 15:46467342-46467364 GAAAGATGTAATTAGCCTAAGGG + Intergenic
1126480437 15:49112774-49112796 AAAAGATATAGACGGCTGAATGG + Intronic
1126947690 15:53842004-53842026 AAAAGACATCAACATCTTAATGG - Intergenic
1127483250 15:59396544-59396566 GAAGGTTTTATACAGCTTAAAGG - Intronic
1127534625 15:59878708-59878730 GACAGATATTTAGAGCTTAAAGG + Intergenic
1127587750 15:60394714-60394736 GAAAAAAAAAAACAGCTTCAGGG + Intronic
1127911937 15:63423792-63423814 TAAATACATAAATAGCTTAAAGG - Intergenic
1129042036 15:72696536-72696558 GGAAGAAAGAAACAGATTAATGG - Intronic
1132167370 15:99608361-99608383 GAAAAATAAAAGAAGCTTAAGGG - Intronic
1133571731 16:7047559-7047581 AAAAGATATAAACAATTTCAAGG - Intronic
1135547882 16:23377945-23377967 GAAATAAATAAACAGGTTATGGG + Intronic
1139063444 16:63284218-63284240 GTAAGATATGAACATCTTTAAGG + Intergenic
1140959776 16:79900560-79900582 GAAGGAAAAAAACATCTTAATGG + Intergenic
1141378198 16:83551042-83551064 GATAGATATAAATGACTTAAGGG - Intronic
1144289321 17:13810286-13810308 AAAAGATAAAAAAATCTTAAAGG + Intergenic
1146072801 17:29699775-29699797 AAAAGAAATAAAAAGCTTAGTGG + Intronic
1148035130 17:44654782-44654804 TAAATATAAAAACAGCCTAAAGG + Intergenic
1148258420 17:46157085-46157107 GAAAAATATAAACATTTTCAAGG - Intronic
1148973403 17:51505053-51505075 TAAATATCTAAAGAGCTTAATGG + Intergenic
1150253664 17:63725650-63725672 GAAAGAAAGAAACAGATTATCGG - Intronic
1150717601 17:67585231-67585253 GAAAGCTATAAACAGACTAGAGG + Intronic
1150833702 17:68545471-68545493 GAAAAATGTATACATCTTAATGG + Intronic
1150996757 17:70327336-70327358 GCAAGGTATAAACAGATTTAAGG - Intergenic
1153068204 18:1072498-1072520 GAAAGATAGAAATTGATTAAAGG + Intergenic
1153103566 18:1501607-1501629 GAAAAATCTACACAGCTTATTGG + Intergenic
1153562483 18:6385097-6385119 GAGTGAGATAAAAAGCTTAAAGG + Intronic
1153936648 18:9932561-9932583 GAAAGAAAGAAACAGTTTATAGG - Intronic
1154402194 18:14050811-14050833 GAAAGAAAAAAATAGCTTAGTGG - Intergenic
1155137814 18:23013835-23013857 CAAAAATAAAGACAGCTTAAAGG + Intronic
1155223445 18:23706632-23706654 GAAAAATATAAATAGTTCAATGG - Intronic
1155798302 18:30068186-30068208 GATAGATATAATGAGTTTAATGG + Intergenic
1156174811 18:34531511-34531533 GAAAGTTATAAACTGGATAATGG - Intronic
1156671480 18:39474935-39474957 GAAATAAATAAACTGCTGAATGG + Intergenic
1157978150 18:52349869-52349891 GAAAGATATAAACAAACTAGAGG - Intronic
1159232914 18:65632406-65632428 CAGAGATAAAAAGAGCTTAAGGG + Intergenic
1159788033 18:72738715-72738737 TAAATATATAAATAGCTTATTGG - Intergenic
1159974360 18:74692302-74692324 AAAGGATAAAAACAGCTAAAAGG - Intronic
1162652029 19:12096091-12096113 GAAGGATATAAACATTTTCAAGG + Intronic
1163303681 19:16463733-16463755 GAAAATTATAAACGGCTAAATGG + Intronic
1166910291 19:46149514-46149536 GAAAGAGAGGAACAGCTAAATGG - Intronic
925710942 2:6739690-6739712 GAATTATATAAACAGTTTGAGGG - Intergenic
925715129 2:6776981-6777003 AAAAGAAAAAAACACCTTAAAGG + Intergenic
926031070 2:9589154-9589176 CTTACATATAAACAGCTTAATGG + Intronic
926846206 2:17142862-17142884 GTAAAATAAAAACAGCTTACAGG + Intergenic
927075535 2:19573407-19573429 ATAATATATAAACATCTTAAAGG + Intergenic
928065295 2:28158619-28158641 GAAAGAGACAAACAGCAGAATGG - Intronic
928212355 2:29332893-29332915 AAAAGGTATAAACATTTTAAAGG + Intronic
929280615 2:40073917-40073939 GAAAACTATAAACATCTTAGGGG - Intergenic
929476274 2:42252750-42252772 GAAAGAAATAGACAGCTGAAAGG - Intronic
930319892 2:49841368-49841390 GAGAGGTATAAAAAGCTAAAAGG - Intergenic
930441226 2:51409282-51409304 AAAAAATATAAAAAACTTAAAGG - Intergenic
932147953 2:69340922-69340944 GAAAGATGTAAACACGTTAGTGG - Intronic
933127705 2:78631404-78631426 TAAAGATATAAATAAGTTAAAGG - Intergenic
933224748 2:79734602-79734624 GAAAGATTAAAACATCTTAAGGG + Intronic
934184830 2:89662477-89662499 TAACAATATAAACAGCTTACTGG - Intergenic
934295105 2:91736610-91736632 TAATAATATAAACAGCTTACTGG - Intergenic
934956619 2:98627218-98627240 GAAATGTATAAAGAGCTTGATGG + Intronic
935850125 2:107209723-107209745 GCAAGCTATAGATAGCTTAAAGG + Intergenic
939062151 2:137435255-137435277 GAAAGATACAAACTTTTTAAGGG + Intronic
939215812 2:139236915-139236937 TAAAGGTATGAACAGGTTAAGGG + Intergenic
939835837 2:147128473-147128495 GAATGAAATAAAGAGCATAATGG + Intergenic
940237149 2:151524122-151524144 GAAAGGTCTAGACAGCTTAGAGG + Intronic
941030607 2:160507306-160507328 AAAAGATATAAACTCCTCAAGGG + Intergenic
941179351 2:162239384-162239406 GAAAGATATAAGAAGCTGAAGGG - Intronic
941245549 2:163091640-163091662 GAAAGCTATAGATAGCTTACAGG - Intergenic
941295181 2:163729252-163729274 GAAATATATATATAGCTAAAGGG + Intronic
941568268 2:167136662-167136684 GAAAAATATAAATAACTTATTGG + Intronic
941674701 2:168331183-168331205 AAAAGATATAGACAGCTGAGTGG + Intergenic
941787940 2:169519122-169519144 TAAAATTATAAACAGCGTAAAGG - Intronic
942441488 2:176041919-176041941 AAAAGCTGTAAGCAGCTTAAGGG + Intergenic
944824392 2:203467088-203467110 GAAAGATATAAACAGCTTAAGGG + Intronic
945205026 2:207322601-207322623 GAAAGATACAAATAGGTTGAAGG + Intergenic
945345889 2:208715705-208715727 GAAATATTTTAGCAGCTTAAAGG - Intronic
945626119 2:212208468-212208490 GAAAGATATAAACAGGGCTAAGG + Intronic
945758769 2:213884420-213884442 GAAAAAGAAAAACATCTTAAAGG - Intronic
947129702 2:226908791-226908813 AAAAGAAATAAACATTTTAATGG - Intronic
947279625 2:228436179-228436201 GTAAGATATCAGCAGTTTAAAGG - Intergenic
1170298170 20:14852291-14852313 GAAAGATACACAGAGCTAAAAGG + Intronic
1170409030 20:16068358-16068380 CAAAGATATACACAGATGAATGG - Intergenic
1171823792 20:29877021-29877043 GAAAGACACAGACAGCTTGAAGG - Intergenic
1172595312 20:36147184-36147206 AAAAGATAGAAACAGCTTTCTGG + Intronic
1173063518 20:39684744-39684766 GAAAGAAATAATCACCTTAAGGG - Intergenic
1174737071 20:52974082-52974104 AAAAGATAAGAACAGGTTAATGG + Intronic
1174776241 20:53345681-53345703 GAAAGATATAATCAACAGAATGG - Intronic
1176976132 21:15324692-15324714 GACAGAAAGATACAGCTTAATGG - Intergenic
1176992333 21:15512265-15512287 GAAAAATATTAACATTTTAATGG - Intergenic
1177421803 21:20869202-20869224 GAGAGATCTAAATAGGTTAATGG + Intergenic
1177974725 21:27833227-27833249 TAAAAATATAAAAAGCTTGAGGG + Intergenic
1178272774 21:31208055-31208077 GACAGAAATAAACACTTTAAAGG + Intronic
1180816819 22:18794893-18794915 TAATAATATAAACAGCTTACTGG + Intergenic
1181203010 22:21229240-21229262 TAATAATATAAACAGCTTACTGG + Intergenic
1181922482 22:26331312-26331334 AAAGGATAAAAACAGCCTAAGGG - Intronic
1184962258 22:47939553-47939575 GAAGGATAAAAACAGATTAATGG + Intergenic
1203223911 22_KI270731v1_random:66186-66208 TAATAATATAAACAGCTTACTGG - Intergenic
1203266918 22_KI270734v1_random:20614-20636 TAATAATATAAACAGCTTACTGG + Intergenic
949243925 3:1903181-1903203 GAAAGACAGAAACGGTTTAAAGG + Intergenic
950132621 3:10557714-10557736 GAAAGATAAAAACAGAATAATGG - Intronic
950249413 3:11451980-11452002 GAAACATAAAAACAGATTCATGG + Intronic
950599479 3:14019546-14019568 GAAAGATATGCACAGATTTAAGG - Intronic
950868221 3:16206700-16206722 GAAAGAAATACACAGCATAGAGG + Intronic
950936076 3:16840696-16840718 GAAAGATATAAACATTTTAAAGG - Intronic
951233246 3:20204322-20204344 GAAGGATATAAACAGCTCTTTGG - Intergenic
951647530 3:24909623-24909645 GAAAGGTAGAGATAGCTTAATGG - Intergenic
951667058 3:25138268-25138290 GCAAAATATAAACAGCTAACTGG - Intergenic
953503325 3:43459207-43459229 AAAAGATAAAAACAACTTAGTGG - Intronic
954335752 3:49916399-49916421 GAAAGAATTACATAGCTTAAAGG - Intronic
954987941 3:54812211-54812233 TAAAGATATAAGCAGTTAAATGG - Intronic
955115016 3:55989351-55989373 TTTACATATAAACAGCTTAATGG - Intronic
956558610 3:70549079-70549101 GAAATGTATAAACAGATGAATGG - Intergenic
957188254 3:76971729-76971751 GAATGCTATTAATAGCTTAAAGG + Intronic
958115773 3:89216132-89216154 CAAACAAATAAACTGCTTAATGG - Intronic
958143499 3:89593459-89593481 TAAGGATATAAACAGGTTCAAGG + Intergenic
958632461 3:96700992-96701014 AAAAGAGAAAAACAGTTTAAGGG - Intergenic
958776861 3:98495646-98495668 GAAAAATTTAAACACCTAAATGG - Intergenic
958844307 3:99247153-99247175 TAAATATATAAAAAACTTAATGG + Intergenic
959366352 3:105463280-105463302 GAAAGAGAAAACCATCTTAATGG - Intronic
962911697 3:139857537-139857559 GCAAGATATAAACATCTACATGG - Intergenic
964564354 3:158033390-158033412 TAAAGAAATAGACATCTTAAAGG + Intergenic
964778877 3:160313252-160313274 GAATGATATAAAAACTTTAAAGG + Intronic
966485605 3:180466089-180466111 GAAAGATATTAACATTTAAAAGG - Intergenic
966658379 3:182385519-182385541 GAAAGTTATAAATTGCTTAGAGG + Intergenic
967590250 3:191265425-191265447 TAAAGCTATGAACAGGTTAAAGG - Intronic
968676797 4:1886505-1886527 GATAAATAGAAACAGCTGAAAGG - Intronic
971496614 4:27273510-27273532 TCAAGATATAATTAGCTTAAAGG - Intergenic
972475308 4:39444361-39444383 AAAAGACAGAAACAGCTTGAGGG - Intronic
974475920 4:62379791-62379813 GAAAAATATAAAAATCTTAGTGG - Intergenic
975416430 4:74110368-74110390 GAAAGAGAAAACCAGCTAAAGGG - Intergenic
976021554 4:80634575-80634597 GAAAGTTTTAAACAGCTAAGCGG - Intronic
976740672 4:88353562-88353584 GTAAGTTATAAATAGCTCAAGGG + Intergenic
976942831 4:90727397-90727419 GAAAACTATAAAAAACTTAATGG - Intronic
977561702 4:98539514-98539536 GAAAGGAATAAACAGCTTACTGG + Intronic
977655601 4:99517433-99517455 GAAAGATAGAAACAGGTTCTGGG + Intronic
978061936 4:104349853-104349875 GAAGGAGATAAACACTTTAAGGG + Intergenic
978818865 4:112941079-112941101 GAAGAATATGAACATCTTAAAGG - Intronic
979598804 4:122563807-122563829 AAAATCTATAAACAGTTTAATGG - Intergenic
979641258 4:123014684-123014706 GAAAAATATTATCAACTTAAAGG - Intronic
980084980 4:128381644-128381666 GAAAGATAAAAGCAGCTTAGAGG - Intergenic
980889692 4:138801279-138801301 TAAAGATATAAATATCTTTATGG - Intergenic
982309466 4:153969565-153969587 GAAAGAAATAAAAATATTAAAGG - Intergenic
982450272 4:155544379-155544401 TAAAGATATAAACCACATAATGG + Intergenic
982607335 4:157531276-157531298 GAAATACATCAACAGCTAAAAGG - Intergenic
982658807 4:158181737-158181759 GATAAATATAAACTGTTTAAAGG + Intergenic
983056116 4:163100680-163100702 GAAGGAGAAAAACAGATTAAAGG + Intergenic
984194607 4:176643471-176643493 GAAAGAAATAAAGAGCCTAAAGG + Intergenic
984433096 4:179673648-179673670 AAAATATATAGACAGCTAAAAGG + Intergenic
984480553 4:180295679-180295701 TAAAGGTATACACAGATTAAGGG - Intergenic
984580609 4:181505478-181505500 GGAAAAAATAAACAGCTTATTGG - Intergenic
985095092 4:186405124-186405146 GAAAGATAAAAACACCTGCATGG - Intergenic
985159503 4:187029595-187029617 GAAAGATACGAACAGCTTAAAGG + Intergenic
988252064 5:28771903-28771925 GAAAGATAAATACAGTTTCAGGG + Intergenic
988542303 5:32121518-32121540 GAAAGACTTGAACAGCTTCAGGG + Intergenic
988557703 5:32251925-32251947 GAATGATACAAAAAACTTAAAGG + Intronic
988650589 5:33145791-33145813 TAAAGATAGAAACAGATTAATGG + Intergenic
988739175 5:34053073-34053095 AACAGAGATAAACATCTTAAAGG + Intronic
988923245 5:35963549-35963571 GAAAGAAAAACACAGCTTAAGGG + Intronic
989472571 5:41837419-41837441 GAAATATGTAAAAAGCTTAAAGG + Intronic
989522929 5:42422622-42422644 GAAATGTTTAAACAACTTAAAGG - Intergenic
990037584 5:51340966-51340988 GATAGAAATAAACAGATCAATGG + Intergenic
990356345 5:54970146-54970168 GAAAGGTATGAGCAACTTAAGGG + Intergenic
990535788 5:56720568-56720590 AACTGATATAAACAGCTAAAGGG - Intergenic
990631626 5:57676555-57676577 GAAAGAGACAGGCAGCTTAATGG - Intergenic
991319020 5:65347769-65347791 AAAATATATAAACAACTCAATGG + Intronic
991365629 5:65865103-65865125 AAACAATATAAACAGCTTACAGG - Intronic
991430994 5:66546270-66546292 GAAAGACATAAAAATCCTAAAGG - Intergenic
992972390 5:82075265-82075287 GCAAGATATAAAGAGCTTGCTGG + Intronic
993488311 5:88514336-88514358 GAAAGAAATAAACAGAGGAAGGG + Intergenic
993664812 5:90682685-90682707 GAAAGATAAAAAAAGCGTTAAGG + Intronic
993748286 5:91630196-91630218 AAAAGATAAAAAGAGCTTTAGGG + Intergenic
993963740 5:94334279-94334301 GAAAGACATAAATAGTGTAAAGG + Intronic
994021521 5:95031353-95031375 GAAAGAAAAAAAAATCTTAAAGG + Intronic
994109967 5:95991029-95991051 GAAATATATGAATAGTTTAAAGG + Intergenic
994145200 5:96387194-96387216 AAAATATATTAACAACTTAAAGG - Intergenic
994192509 5:96884020-96884042 GATAGATAAAAACAAATTAATGG - Intronic
994498380 5:100542196-100542218 GAAAGTAATTAACAGCTTAGAGG - Intronic
994602925 5:101929706-101929728 GAAGGATATACACAGTTTATGGG - Intergenic
994805029 5:104434675-104434697 AAAAGAGAAAAACAGCTGAATGG + Intergenic
996531592 5:124533174-124533196 GAAAGAAACAAACAGCTTGCTGG + Intergenic
997818539 5:137041145-137041167 AAAAAAAATAAACAGATTAATGG + Intronic
997890839 5:137675322-137675344 GAAAGATATAATTAACTCAATGG + Intronic
997907103 5:137828843-137828865 GAAAGATATTAACAGGTGGAGGG - Intergenic
1000523099 5:162321319-162321341 AAAAGAAATAAACAGAATAAGGG + Intergenic
1000549608 5:162643997-162644019 GACAAATTTTAACAGCTTAATGG + Intergenic
1001057278 5:168460114-168460136 AAAAGAAAAAGACAGCTTAAAGG - Intronic
1001602137 5:172935834-172935856 GATAGAAATAATCAGCATAAAGG - Intronic
1002842941 6:921846-921868 CAAAGAGAAAAACAGTTTAAGGG - Intergenic
1003379634 6:5611600-5611622 AAAAAATATAAAAAGTTTAATGG - Intronic
1003875050 6:10428029-10428051 TAAAGATATAAATATCTTAGGGG - Intergenic
1003942051 6:11039093-11039115 GAAAGATGTATACAGCCAAAGGG + Intronic
1004019991 6:11768716-11768738 GAACCAAATAAACAGCTCAAAGG + Intronic
1004379717 6:15122246-15122268 GAAAGTTTGAAACAACTTAAAGG - Intergenic
1004646142 6:17562773-17562795 AAAAGCTGTAAATAGCTTAAAGG + Intergenic
1005735829 6:28744889-28744911 GAAATATTTAAACATTTTAAAGG - Intergenic
1006385788 6:33730116-33730138 GGGAGAAATAAACAGCTTGAAGG - Intronic
1007060113 6:38931771-38931793 TAAAATTAAAAACAGCTTAAAGG - Intronic
1007145082 6:39621340-39621362 AAAAGTTATGAACAGCTTTAAGG + Intronic
1007185636 6:39969684-39969706 GAACTATACAAACAGATTAAAGG + Intergenic
1007814434 6:44510578-44510600 AAAACATAAAAACATCTTAAAGG + Intergenic
1007839320 6:44702704-44702726 GAAAGAAATAAACAGCTACCAGG + Intergenic
1007853976 6:44835076-44835098 GATAGATATACATAGCTGAAAGG + Intronic
1010207337 6:73334743-73334765 GAAATATATAGAGGGCTTAAGGG + Intergenic
1011281552 6:85682852-85682874 TGAAGAGATAAACATCTTAAAGG - Intergenic
1011286414 6:85729176-85729198 GAAAAAGAAAAAAAGCTTAATGG - Intergenic
1012439839 6:99252844-99252866 AAAAGAGAAAAACAGTTTAAAGG - Intergenic
1012608145 6:101183494-101183516 GAAAGATGGAAACACATTAAGGG + Intergenic
1012654208 6:101794409-101794431 GAAAGATATGACTAGCTGAATGG - Intronic
1013245043 6:108278226-108278248 GGTAGAGATAAACAGCTGAAGGG + Intergenic
1013523430 6:110953502-110953524 AAAAGCTATAAATAGCTCAAAGG - Intergenic
1013897320 6:115104912-115104934 CAAAGATACAAACAGATTATAGG + Intergenic
1014750220 6:125246691-125246713 GAAAGAAATGAACAGCTTTTAGG - Intronic
1016361431 6:143271821-143271843 GAAAGATATATTCATCTTTAAGG - Intronic
1016528277 6:145028494-145028516 TAATGATATAAACAGCAGAAGGG - Intergenic
1016543205 6:145190263-145190285 GTAAGTTATAGATAGCTTAAGGG + Intergenic
1016592063 6:145756785-145756807 GAAAGAAAAAAAAAGCTTAAGGG - Intergenic
1016769261 6:147830221-147830243 GAAAGAAAGAAAAAGCTTATTGG - Intergenic
1017325602 6:153138186-153138208 AATAGATATAAACATCTTTATGG + Intergenic
1020596476 7:10213416-10213438 AAAAAAAAAAAACAGCTTAAGGG + Intergenic
1023229536 7:38011612-38011634 GAAAGGGAGAAACAGATTAAGGG + Intronic
1023243928 7:38179886-38179908 GGCAGATATAAACAGTGTAAAGG + Intronic
1023421881 7:39989140-39989162 GAAATTTTTAAACATCTTAAAGG - Intronic
1024027737 7:45427770-45427792 GAAATATATAATCAACTCAATGG + Intergenic
1027431441 7:78117262-78117284 CATAGATATAAAAATCTTAAAGG + Intronic
1028831265 7:95328708-95328730 GAAAGAGATAAGTAGGTTAAGGG - Intergenic
1028901945 7:96111660-96111682 GAAAGATATAAAAGACATAAAGG - Intergenic
1028967887 7:96822984-96823006 AAAAAATATAAACAGCAGAATGG + Intergenic
1030625073 7:111836053-111836075 AAAAGAAATAAAAAGTTTAAAGG + Intronic
1030979408 7:116168359-116168381 GGAAGATTTACACAGCTTATTGG - Intergenic
1031557401 7:123194617-123194639 GAAAGAGAAAGACAGCTTCAAGG + Intronic
1032611032 7:133414132-133414154 GAAAAAGATAAACAACTCAATGG + Intronic
1032896021 7:136251666-136251688 GCAAAATATAATCAGCTTGAGGG + Intergenic
1033250399 7:139753581-139753603 GCAAGATACAAAAAGCTTCATGG + Intronic
1035218109 7:157386084-157386106 GAAAGATATTAATACATTAATGG + Intronic
1037189471 8:16105106-16105128 GAAAAGTAAAAAGAGCTTAAGGG - Intergenic
1037542256 8:19883540-19883562 CCAAGATTTAAACAGCTTAGGGG + Intergenic
1037640751 8:20740647-20740669 GAAACATATATGCATCTTAATGG + Intergenic
1037919380 8:22793827-22793849 GAAAGCTATATACATTTTAAAGG + Intronic
1038201359 8:25416042-25416064 GAGAGAAATAAAAAGGTTAAAGG + Intronic
1039336236 8:36593084-36593106 AAAAGTGAAAAACAGCTTAATGG - Intergenic
1039688899 8:39840655-39840677 GATAGATAAAATAAGCTTAATGG - Intergenic
1039760795 8:40572800-40572822 AAAAGCTGTAAACAGCATAATGG - Intronic
1039908501 8:41805038-41805060 GAAAGAAAGAAACAGCTCTATGG - Intronic
1040005643 8:42618639-42618661 GAAACAAATAAACAAATTAAAGG + Intergenic
1040727811 8:50404272-50404294 AAAAGATATAAACAAATAAATGG + Intronic
1041386631 8:57311184-57311206 GAGAGAAAAAAACAGCTGAAAGG + Intergenic
1043179074 8:77060874-77060896 CAAGGAGATAAACAGCTGAAAGG - Intergenic
1043608925 8:82037585-82037607 GACATATATAAACATTTTAAAGG + Intergenic
1044492218 8:92832939-92832961 CAAAGAGATAAAGAGCTGAATGG - Intergenic
1044542323 8:93421758-93421780 GAATGATATATACAGATGAATGG - Intergenic
1045375618 8:101571144-101571166 GAGATATATAAAGAGCTAAATGG + Intronic
1045793574 8:106015751-106015773 GACAGAAATAAACACATTAATGG + Intergenic
1046733055 8:117746578-117746600 GAAAAAGATAAACAGCTAGAGGG + Intergenic
1046807110 8:118491040-118491062 GAAAAATATAAAGCCCTTAATGG + Intronic
1047695090 8:127395519-127395541 GAAAAATATAATCAGATTTATGG - Intergenic
1048496283 8:134938852-134938874 TGAAGATCTAAACAGCTTTAAGG - Intergenic
1048654012 8:136515160-136515182 GAAAATTATAAACACCTTTAGGG + Intergenic
1050281643 9:4056418-4056440 GGAAGATTTTAACAACTTAAAGG - Intronic
1050747743 9:8896989-8897011 AAAAGATAAAAACAAATTAAAGG + Intronic
1050919012 9:11175519-11175541 GAAAAATATAAAAAACATAATGG + Intergenic
1051033776 9:12717986-12718008 TAAAAATATAAACAACATAAGGG + Intergenic
1051035139 9:12735375-12735397 GAAAGTTACAAACAGACTAAGGG + Intergenic
1051498888 9:17755652-17755674 GAAAAACATAGACACCTTAAAGG - Intronic
1051999606 9:23261327-23261349 GACACATATAAACAGATTGATGG + Intergenic
1055181363 9:73391299-73391321 GAAAGAGGTAAACAGAATAATGG - Intergenic
1056083741 9:83124205-83124227 AAAAGATAGAAGCAACTTAAGGG - Intergenic
1056541870 9:87578518-87578540 AAAAGTTATAAACATTTTAAAGG + Intronic
1057036452 9:91815056-91815078 GAAAAATATTAACAGCTATAAGG + Intronic
1057150791 9:92794251-92794273 GAAAAAAATAAGCAGATTAAAGG + Intergenic
1059152967 9:111965898-111965920 GAGAAGTATAAACAACTTAAAGG + Intergenic
1060345756 9:122814333-122814355 GAAAGATATACAGATGTTAATGG + Intronic
1203376868 Un_KI270442v1:383537-383559 GAAAGACACAGACAGCTTGAAGG - Intergenic
1186703246 X:12114022-12114044 AAAAGATACAAAGAGATTAAAGG - Intergenic
1186768444 X:12794074-12794096 GTAATAAATAAAGAGCTTAATGG + Intronic
1188602345 X:31983435-31983457 AAAATATCTAAACTGCTTAAAGG - Intronic
1189495842 X:41508073-41508095 GAAAAGCATAAACATCTTAAGGG - Intergenic
1189569188 X:42276960-42276982 GCAAGACAGAAACAGCTTAGGGG - Intergenic
1189707275 X:43771523-43771545 GAAATATATAGAGAGCCTAAGGG + Intronic
1190845468 X:54186775-54186797 GAAATACATAAACATCTCAAAGG + Intergenic
1191198473 X:57750896-57750918 GTAAGAGATAAATAACTTAATGG + Intergenic
1191910028 X:66140426-66140448 AAAAAAAAAAAACAGCTTAAAGG - Intergenic
1192755918 X:74046980-74047002 GAAAATAATAAAAAGCTTAAGGG - Intergenic
1192791597 X:74387416-74387438 GAAAGATAAACAGAGCCTAAGGG + Intergenic
1192842331 X:74869833-74869855 GAAAGATATATCCATGTTAATGG + Intronic
1193754711 X:85394322-85394344 TAGAGATATAAACAGTTTAGTGG - Intergenic
1194376905 X:93147929-93147951 GAAAGATAATAACATCTGAAAGG + Intergenic
1195837725 X:109137750-109137772 CAAAAATAAAAACAGATTAATGG + Intergenic
1195998613 X:110757752-110757774 GAAAGAAATAAACACCATTATGG - Intronic
1196750283 X:119109964-119109986 GAAAGATAAAAACAAATGAAAGG + Intronic
1197078430 X:122380947-122380969 CAAACATATAAACAGATGAAGGG + Intergenic
1197356479 X:125442198-125442220 GAAAGATAGAAGTAGGTTAAGGG + Intergenic
1197440220 X:126478242-126478264 GAAAGAAAAAAACATGTTAATGG + Intergenic
1197481166 X:126988240-126988262 GAAAGTTATAAAAAGATTATTGG + Intergenic
1198313736 X:135445803-135445825 GAAAAATAAAAACAGCATAAGGG + Intergenic
1198567685 X:137921609-137921631 GAAAGAGAGAGACAGATTAAAGG + Intergenic
1199239245 X:145526986-145527008 GAGAGACATAAGCAGCTTTATGG - Intergenic
1200315321 X:155126583-155126605 TAAAAAAATAAACAGCTTTATGG - Intronic
1201393519 Y:13523740-13523762 GGAAGAAATAATCATCTTAAAGG + Intergenic