ID: 944830586

View in Genome Browser
Species Human (GRCh38)
Location 2:203530399-203530421
Sequence GCTTTGTTTTGATTTCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944830585_944830586 -7 Left 944830585 2:203530383-203530405 CCATTTATTTTTGTATGCTTTGT 0: 1
1: 0
2: 9
3: 196
4: 2019
Right 944830586 2:203530399-203530421 GCTTTGTTTTGATTTCACCCAGG 0: 1
1: 0
2: 3
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944830586 Original CRISPR GCTTTGTTTTGATTTCACCC AGG Intronic
904109217 1:28112345-28112367 GCAATGGTTTGACTTCACCCTGG - Intergenic
905855318 1:41307640-41307662 GCTTTATGGTGAATTCACCCCGG + Intergenic
907977858 1:59449660-59449682 GTTTTGTTTTGTTTTTATCCAGG + Intronic
908000154 1:59671579-59671601 GCAGTGGATTGATTTCACCCTGG + Intronic
908266990 1:62389341-62389363 GTTTTGTTTTGTTTTCAGACAGG + Intergenic
909065272 1:70928625-70928647 GTTTTGTTTTGTTTTCAGACGGG - Intronic
909115869 1:71535689-71535711 TCTTTGTTTTGATCTCACTTTGG - Intronic
909787688 1:79636956-79636978 GTTCTGTTTAGATTTGACCCTGG - Intergenic
910870697 1:91830350-91830372 TCTTTGTTTTGGTTTAGCCCTGG + Intronic
912897908 1:113612608-113612630 GTTTTGTTTTGTTTTCACACAGG - Intronic
913537042 1:119783001-119783023 CCTTGGTTTTGAGTTCCCCCAGG - Intergenic
914673287 1:149888264-149888286 GCTTTGTTTAGTTTACAGCCGGG + Intronic
915004391 1:152623124-152623146 GCTTTGCTTTTATTTTGCCCAGG - Intergenic
916044427 1:160988496-160988518 GCTTTGTTTAGCTTTGACACAGG + Intergenic
916885628 1:169064988-169065010 GTTTTGTTTTGTTTTCAGACAGG + Intergenic
918220053 1:182428470-182428492 GCTTTGTTTTATTTTCCACCTGG - Intergenic
918753601 1:188306448-188306470 GTTTTGTTTTGTTTTTACCATGG + Intergenic
918805496 1:189036221-189036243 GCTTTCTATCGATGTCACCCCGG - Intergenic
919107184 1:193168283-193168305 GCTGTGTTTTGCATTCATCCAGG + Intronic
920268067 1:204741497-204741519 GTTTTGTTTTGTTTTCTCTCTGG + Intergenic
920284658 1:204870852-204870874 GAATTATTTTGATTCCACCCAGG + Intronic
923720969 1:236466632-236466654 GTTTTGTTTTGTTTTCACACAGG - Intronic
924033864 1:239915457-239915479 GGTTTGCTTTTATTTAACCCAGG + Intergenic
924742691 1:246805422-246805444 GTTTTGTTTTGTTTTGAGCCAGG + Intergenic
1064625889 10:17260934-17260956 GCTTTTTTTTTTTTTCACCCAGG + Intergenic
1066000266 10:31098263-31098285 TTTTTGTTTTGTTTTCTCCCAGG - Intergenic
1067021856 10:42807474-42807496 GTTTTGTTTTGTTTTCAGACAGG + Intronic
1067119092 10:43458563-43458585 GATTTATTTTCCTTTCACCCTGG + Intronic
1067146235 10:43695725-43695747 GTTTTGTTTTGTTTTCTGCCGGG + Intergenic
1069097505 10:64277458-64277480 GTTTTGTTTTGTTTGCATCCTGG - Intergenic
1071231550 10:83593641-83593663 GTTTTGTTTTGTTTTCCCCCGGG + Intergenic
1071940159 10:90581464-90581486 CCATTGATTTGATTTCAGCCTGG - Intergenic
1072462828 10:95635827-95635849 GCTTTGGTTTGGTTTTTCCCAGG - Intronic
1073553614 10:104426525-104426547 GTTTTGTTTTGTTTTCAGCCTGG - Intronic
1074396961 10:113105920-113105942 GTTTTGTTTTGTTTTAATCCTGG - Intronic
1074782211 10:116810140-116810162 CTTTTGTTTTGTTTTCCCCCTGG + Intergenic
1075031715 10:119028983-119029005 GGTTTGTATGGATTTCGCCCAGG + Intergenic
1077512203 11:2973585-2973607 GCTGTGGTTGTATTTCACCCAGG - Intronic
1078078742 11:8186698-8186720 TCTATGTTTTGATTTCTCTCTGG + Intergenic
1078600453 11:12725843-12725865 GATTTGTGTTGCTTACACCCGGG - Intronic
1079628159 11:22641080-22641102 GCTTTTTTTTGAATTGACCAAGG + Intronic
1080776113 11:35388398-35388420 GTTTTGTTTTGTTTTGACACAGG + Intronic
1083376087 11:62222713-62222735 CCTTTGTTATGTTTTCACCAGGG - Intergenic
1084561380 11:69907404-69907426 GCTTTTTTTTTTTTTCACACAGG + Intergenic
1087193836 11:95285003-95285025 GCTTTGTTTTGGTGTAACCTAGG - Intergenic
1087607265 11:100392124-100392146 GCTTTATGTTAAATTCACCCCGG + Intergenic
1088235323 11:107717116-107717138 GCTCTCTTTTAATCTCACCCAGG - Intronic
1093621075 12:21289747-21289769 GCTTTTTTTTTTTTTTACCCTGG - Intronic
1094762734 12:33552482-33552504 GCTCTGTTTTCATTTCTCTCAGG + Intergenic
1097477249 12:60073488-60073510 GCATTGTGTTCATTTCACCTTGG - Intergenic
1099672701 12:85715510-85715532 GTTTTGTTTTGTTTTCAATCTGG + Intergenic
1101258206 12:103000754-103000776 GCTTTTTTTTCCTTTCACACTGG - Intergenic
1101381836 12:104220303-104220325 GCTTTTTGTTGATTTTAACCAGG + Intronic
1101627706 12:106461814-106461836 GCCTTGTGATGACTTCACCCTGG + Intronic
1106503591 13:30352613-30352635 GTTTTGTCTTGCTGTCACCCAGG + Intergenic
1107222271 13:37997790-37997812 GTTTTGTTTTGTTTTTAACCAGG + Intergenic
1108038941 13:46321455-46321477 GCCTTCTTTTCATTTCAGCCTGG + Intergenic
1108695738 13:52900900-52900922 TGATTGTTTTGATTTCACCTGGG - Intergenic
1108780652 13:53827078-53827100 ACTTTGTTTTTTTATCACCCAGG - Intergenic
1109740455 13:66547305-66547327 GCTTTGTTTTGTTTTCCACTAGG - Intronic
1109878881 13:68444648-68444670 TCTTTCTTTTGTTTTCCCCCAGG + Intergenic
1110408228 13:75174558-75174580 GCTTTGTTTTCATTTGAGCATGG + Intergenic
1110550447 13:76806105-76806127 GCTTTGTTTTGTTTTGAGACAGG + Intergenic
1111640416 13:90962672-90962694 CATTTGTTTTCATTTCAGCCTGG - Intergenic
1112792383 13:103016979-103017001 CCTTTGTTTCTATTTAACCCAGG - Intergenic
1113733873 13:112662830-112662852 GCTTTATTTTTATTTAACGCAGG + Intronic
1114653609 14:24302597-24302619 GATTTGTTTTGACTTCTCTCAGG + Intronic
1115084460 14:29497062-29497084 GCTTTGTTTTGTTTTCAAAATGG - Intergenic
1115218729 14:31037944-31037966 GCTTTGTTTTGTTTTGAGACAGG - Intronic
1115590323 14:34858139-34858161 GCTTTGTTTTTTGTTCACCTTGG - Intronic
1115663451 14:35520842-35520864 CCTATGTTTTAATTTCAACCAGG - Intergenic
1115810841 14:37105480-37105502 GCTTTGTGGTGATTTGGCCCTGG - Intronic
1116930986 14:50690798-50690820 ACTTTTTTTTTTTTTCACCCAGG + Intergenic
1118031127 14:61819033-61819055 CCTATGTTTTCATTTCACCATGG + Intergenic
1118527427 14:66661739-66661761 ACAATGTTTTGATTTCACCCTGG + Intronic
1118642038 14:67801953-67801975 GCCTTGGTTTTATTTCACCCAGG - Intronic
1119546670 14:75477055-75477077 GTTTTGTTTTGTTTTCAGACAGG + Intergenic
1122282798 14:100634154-100634176 GCTGTGTTCTGATTTCACCTGGG + Intergenic
1122611701 14:102988287-102988309 GTTTTGTTTTGATTTCTTTCAGG - Intronic
1124108388 15:26762890-26762912 TCTTTCTTTTGATTTGGCCCTGG - Intronic
1124624623 15:31300747-31300769 TCTTTTTTCTCATTTCACCCAGG - Intergenic
1125285212 15:38085365-38085387 ACATTGTTTTGAGTTCCCCCTGG - Intergenic
1125325333 15:38530756-38530778 ACTTAGTTTTGATCTCACCCAGG - Intronic
1125359143 15:38847697-38847719 GCTTTCTTCTGATTTCCCCATGG + Intergenic
1127347716 15:58117252-58117274 TCTCTGTTCTAATTTCACCCTGG + Intronic
1128403080 15:67305208-67305230 TTTTAGTTTTGATTTCACCAAGG - Intronic
1128931588 15:71709350-71709372 GCTTTGATTTTTTTTCACACAGG - Intronic
1129474659 15:75776522-75776544 GTTTGGTTTTGTTTTCTCCCAGG + Intergenic
1130604738 15:85306119-85306141 GTTTTGTTTTGTTTTTAACCTGG - Intergenic
1130642364 15:85690171-85690193 GTTTTGTTTTGTTTCCATCCTGG + Intronic
1130872065 15:87979306-87979328 TCCTTGTTTTGATGTCACCTTGG - Intronic
1133646319 16:7768037-7768059 GTTTTGTTTTGATTTGTCCTTGG + Intergenic
1133898900 16:9954696-9954718 GTTTTGTTTTGTTTTAAGCCAGG - Intronic
1134357403 16:13496159-13496181 GTTTTGTTTTGTTTTCTGCCTGG - Intergenic
1134534504 16:15014904-15014926 AATTTGTTTTGTTTCCACCCAGG - Intronic
1135045587 16:19152586-19152608 GCTTTGTTTTGTTTTGAGACAGG + Intronic
1136279840 16:29201802-29201824 GCAGTGTTTTGATGTCAGCCAGG + Intergenic
1138170276 16:54842715-54842737 ACTTTATTTTATTTTCACCCTGG + Intergenic
1139022986 16:62775618-62775640 TTTTTTTTTTGAGTTCACCCAGG + Intergenic
1139668789 16:68477381-68477403 GTTTTGTTTTGTTTGCAGCCAGG + Intergenic
1139847757 16:69932768-69932790 GCATTGTCTTGCCTTCACCCTGG + Intronic
1139861541 16:70025873-70025895 AATTTGTTTTGTTTCCACCCAGG + Intergenic
1140725351 16:77806848-77806870 GCCATGTCTTGATTTCTCCCTGG - Intronic
1140985150 16:80151672-80151694 GTTTTGTTTTGATTTTTCCTTGG - Intergenic
1142084233 16:88167911-88167933 GCAGTGTTTTGATGTCAGCCAGG + Intergenic
1142252533 16:88999112-88999134 GCTTTGTTTTGTTTTGAGACAGG - Intergenic
1143252049 17:5530574-5530596 GCTGTGGGTTGATCTCACCCAGG + Exonic
1143942575 17:10557873-10557895 GCTTTGTTTTGATTGCCCTGTGG + Intergenic
1144262040 17:13531166-13531188 GCTTTGCTTTGAATTCACTTAGG - Intronic
1144286959 17:13786242-13786264 TTTTTGTTTTCATTTCACTCCGG - Intergenic
1145986822 17:29052563-29052585 GCTTTGTTTTGCTTTGAGACAGG + Intronic
1146637094 17:34514574-34514596 GCCTTGTTTTTATTTCATCTGGG + Intergenic
1146823556 17:36003806-36003828 GATTTGTTTTGTTTTGACACAGG - Intergenic
1147854823 17:43471503-43471525 GATTTGTTTAAAATTCACCCAGG + Intergenic
1147863726 17:43539420-43539442 TCTATGTTTTGTTTTCTCCCTGG + Intronic
1149968180 17:61189095-61189117 GTTTTGTTTTGTTTTCAGGCAGG - Intronic
1151646523 17:75436179-75436201 GTTTTGTTTTGATTTTATCATGG - Intergenic
1152147917 17:78580337-78580359 TGTGTGTTTTGATTTCTCCCTGG - Intergenic
1153118680 18:1692915-1692937 CTTTTCTTTTTATTTCACCCAGG - Intergenic
1154375734 18:13808163-13808185 GTTTTGTTTTGTTTTCAGACAGG - Intergenic
1154971395 18:21413243-21413265 ACTTTGTTTCCATTTCCCCCAGG + Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156200201 18:34821998-34822020 GCTTTGTTTTGCTTGTTCCCGGG + Intronic
1156276533 18:35589041-35589063 GCTTTGTTTTGATACCACCCTGG + Intronic
1156825040 18:41420579-41420601 TCTTTGTGTTCATTCCACCCTGG + Intergenic
1157194630 18:45610784-45610806 GGTTTGTTTTGCTCTAACCCTGG + Intronic
1159637224 18:70820328-70820350 GTTTTGTTTTGTTTTGAACCTGG - Intergenic
1160181672 18:76642163-76642185 GGTTTGTTTTTTTTTCACCCAGG + Intergenic
1160390511 18:78527849-78527871 GTTTTGTTTTGTTTTCAGTCGGG - Intergenic
1160541979 18:79628825-79628847 GCTTTGTGTTTATTTCACGCTGG - Intergenic
1163036303 19:14571149-14571171 GCTTTGTTTTGCTTTGAGACGGG - Intronic
1163266180 19:16223880-16223902 GCTTTCTTTTGTGTTCACGCTGG + Intronic
1164838580 19:31375116-31375138 GTTTTGGTTTGTGTTCACCCTGG - Intergenic
1167193754 19:48012129-48012151 GTTTTGTTTTGTTTTCAGACAGG + Intronic
1168288320 19:55345366-55345388 GCTTGGTTTTTAGGTCACCCTGG + Intronic
926220053 2:10929814-10929836 CCTTTATTTTGCTTTCACACAGG + Intergenic
929304269 2:40342580-40342602 GCTTTCTTTCTATTTCCCCCAGG + Intronic
929822872 2:45287550-45287572 CCTTTTTTTTTTTTTCACCCGGG + Intergenic
931009822 2:57897671-57897693 GCTTTGTTTTGTTTTTACATGGG - Intergenic
931756246 2:65377277-65377299 GCTTTGTCTTGATTTCAGATGGG - Intronic
932194405 2:69770614-69770636 GCATTGTGGTGAATTCACCCCGG - Intronic
933481712 2:82866202-82866224 GTTTTGTTTTGTTTTCCCCATGG + Intergenic
935344585 2:102093997-102094019 GTTTTGTTTTGTTTTCCCCAGGG - Intronic
935598367 2:104897401-104897423 GCTCTGTTTTCCTTTCTCCCAGG - Intergenic
936953142 2:117998318-117998340 TGTTTGTTTTGTTTTCCCCCCGG - Intronic
937034198 2:118767071-118767093 GCCTTGTTGTGATTTCACAGCGG + Intergenic
938972998 2:136449243-136449265 GCTTTAATGAGATTTCACCCAGG + Intergenic
938989212 2:136610740-136610762 GTTTTGTTTTGTTTACACCTTGG - Intergenic
939104128 2:137929372-137929394 CCTGTGTCTAGATTTCACCCTGG + Intergenic
939253973 2:139718881-139718903 ATTTTGTTTTGTTTTCCCCCTGG - Intergenic
940537575 2:154965970-154965992 TCTTTGTTTTGCTTTCAACAAGG - Intergenic
942475285 2:176313074-176313096 GCTTTCTTTTGAAGTCACCAAGG + Intronic
943852845 2:192749679-192749701 GCTTTGTTTTTATTTAACTTAGG - Intergenic
944230503 2:197387280-197387302 CCTCTCTTTTAATTTCACCCAGG + Intergenic
944830586 2:203530399-203530421 GCTTTGTTTTGATTTCACCCAGG + Intronic
945528522 2:210920948-210920970 GTTTTGTTTTGTTTTTTCCCTGG - Intergenic
946640672 2:221780426-221780448 GTTTTGTTTTGTTTTAAACCTGG + Intergenic
947415563 2:229891594-229891616 GTTTTGTTTTGTTTTGACGCAGG - Intronic
1172572610 20:35982309-35982331 GCTAAGTTTGGATTTTACCCAGG - Intronic
1173137716 20:40454558-40454580 GCTTTGCTTTGTTTTCTGCCTGG - Intergenic
1173954512 20:47020465-47020487 TCTTTATTTTAAGTTCACCCTGG + Intronic
1174359987 20:50022894-50022916 GTTTTGTTTTGTTTTGACACTGG - Intergenic
1174467239 20:50727252-50727274 GCTTCTTTTTGTTTTCACACCGG - Intergenic
1175426935 20:58873791-58873813 GGTTTGTTTTGATTCCATCAAGG - Intronic
1176176446 20:63728507-63728529 TCTTTGCTTTCACTTCACCCTGG + Intronic
1177655403 21:24010707-24010729 GCTTTGTTTTTATTTGACACTGG + Intergenic
1178724582 21:35039644-35039666 TCTTTGTTTTGAATACAACCTGG + Intronic
1180002111 21:44999901-44999923 GCTTTGCTTTGAGATCAGCCAGG + Intergenic
1180586460 22:16896939-16896961 GTTTTGTGGTTATTTCACCCTGG - Intergenic
1182505329 22:30778223-30778245 GCATTGTTTTTATTTCACCATGG - Intronic
1184063020 22:42096398-42096420 GGTTTGTTTTTTTGTCACCCAGG - Intergenic
1184079444 22:42208575-42208597 GTTTTGTTTTGTTGTCACTCAGG - Intronic
1185415745 22:50709116-50709138 GCTTTGTTTTGTTTTGAGACAGG - Intergenic
950380881 3:12613783-12613805 GCTTTATTTTGCTATCACCAGGG + Intronic
953395320 3:42564761-42564783 GTTTTGTTTTGTTTTGACACAGG + Intronic
953952396 3:47201266-47201288 GTTTTGTTTTGTTTTCAGACAGG + Intergenic
955101491 3:55854272-55854294 GCTTTATTTTGTTTTCCCCTGGG - Intronic
955122536 3:56075140-56075162 GCTCTGTTTTTATGTCACTCAGG - Intronic
955884700 3:63585299-63585321 CCTTGGTTTTCATTTCATCCTGG - Intronic
956498567 3:69855868-69855890 GTTTTGTTTTGTTTTCCCCTGGG + Intronic
956547734 3:70424485-70424507 GTTTTTTTTTAATTTCACACTGG + Intergenic
957882595 3:86239448-86239470 TTTTTGTTTTGCTTTAACCCAGG - Intergenic
958995786 3:100903626-100903648 TCTTTGTTTTGTTTTCATTCTGG + Intronic
959702448 3:109310805-109310827 GCTTTGTTTTGTTTTGAGACAGG + Intronic
960617185 3:119606752-119606774 GTTTTGTTTTGTTTTCCTCCAGG + Exonic
961509770 3:127393671-127393693 CCTCTGTTCTGAATTCACCCCGG - Intergenic
961925179 3:130471965-130471987 CCTTTGTTTGGATTTTCCCCTGG + Intronic
962178670 3:133182314-133182336 ACATTGGTTTGATTTCTCCCTGG + Intronic
962234210 3:133693816-133693838 GCTGTGTTTAGAGTTCAGCCTGG + Intergenic
963926341 3:150955409-150955431 GCTTTGATTTGTTTTCAGTCGGG - Intronic
964956801 3:162369287-162369309 GCTTTGTTTTGTTTTCATTTTGG - Intergenic
965173770 3:165302485-165302507 GTTTAGCTTTGAATTCACCCAGG - Intergenic
967103811 3:186239194-186239216 GTTTTGTTTTGTTTTCAGCAAGG - Intronic
967274958 3:187765315-187765337 GCTTTGGATTTATTTCAACCTGG - Intergenic
967486963 3:190043950-190043972 GTTTTGTTTTGACATCTCCCTGG - Intronic
967778316 3:193407752-193407774 GCTTTGTTTTGTTTTCAAAAGGG + Intronic
967918934 3:194600095-194600117 GTTTTGTTTTGTTTTCAGACAGG + Intronic
969757734 4:9161107-9161129 GCTGTCCTTTGATGTCACCCTGG - Intergenic
970105967 4:12584763-12584785 GTTTTTTTTTTATTTCAACCAGG - Intergenic
970708850 4:18838511-18838533 ACTTTGTTTTGATAACACCCTGG - Intergenic
972479767 4:39486245-39486267 GCTTCTGTTTGATGTCACCCTGG - Intergenic
972950482 4:44316412-44316434 GGTTTGTTTTTAGTTCATCCTGG + Intronic
973112456 4:46412734-46412756 GCATTATTGTGATTGCACCCTGG - Intronic
973229409 4:47824629-47824651 TCTTTGTTTTAATTTCAAACAGG + Intronic
974304178 4:60110337-60110359 GCCTTATTTTGATTTTACACAGG + Intergenic
976536148 4:86220327-86220349 GTTTTGTTTTGTTTTTACTCTGG - Intronic
976570163 4:86597958-86597980 GTTTTGATTTGTTTTCACACTGG + Intronic
978331990 4:107623504-107623526 TGTTTGTTTTAATATCACCCAGG + Intronic
979359157 4:119741227-119741249 GTTTTGTTTTGTTTTCTTCCAGG - Intergenic
980120380 4:128721921-128721943 GCTTTCTTTTGATTTCATATAGG - Intergenic
980951691 4:139385243-139385265 GTTTTGTTTTGATTTGAAACAGG - Intronic
981121858 4:141060574-141060596 CCTTTGTTTACATTTTACCCTGG - Intronic
981224243 4:142273689-142273711 TCCTTGCTTTGATTCCACCCAGG - Intronic
981789889 4:148524758-148524780 TCTTTTTTTTTTTTTCACCCAGG + Intergenic
983928361 4:173426851-173426873 GCTTTACTTTGATCTCTCCCTGG + Intergenic
985728986 5:1535640-1535662 TCTTTGTTTTGCTTTCACTATGG + Intergenic
986862860 5:11948368-11948390 GCTTGATTTTGTTTTCAGCCTGG + Intergenic
987379417 5:17271146-17271168 GCTTTGTTTTGTTTTGAGGCAGG + Intronic
988819551 5:34867562-34867584 GTTTTGTTTTGTTTTCCCCCGGG - Intronic
990307649 5:54508763-54508785 GCTTTGTTTTGTTTTGAGTCAGG + Intergenic
990751441 5:59021111-59021133 GCTTTGCTTTTCTCTCACCCTGG - Intronic
992660317 5:78953531-78953553 GTTTTGTTTTGCTTTCAATCAGG - Intronic
993064791 5:83084137-83084159 GCATAGTTTTGATTCCAACCTGG + Intronic
993340275 5:86717090-86717112 GTTTTGTTTTGTTTTTACCAAGG + Intergenic
993572716 5:89561733-89561755 GCTTTGTTTTCTTTTATCCCAGG - Intergenic
993594402 5:89834718-89834740 GCTTTGTTTTGAAGTCACCTAGG - Intergenic
994271688 5:97784696-97784718 TATTTGTTTTGTTTTCTCCCAGG - Intergenic
995065523 5:107857703-107857725 GCTTTCTTTTGCTTTCTCGCAGG + Intergenic
995370410 5:111411996-111412018 GCTTTATTTTTATTTCAAGCTGG - Intronic
995530949 5:113091454-113091476 GCTTTATTTTCATTTCCCCTAGG - Intronic
995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG + Intergenic
998273913 5:140733455-140733477 GCTTTATTTTTATTTCACAGAGG - Intergenic
999727634 5:154449635-154449657 GCTTTGTTGTGCTTTCTTCCTGG + Intronic
999894549 5:156016165-156016187 GCTTTGTTTTGTTTTTACCGAGG - Intronic
1000183891 5:158840268-158840290 CCTTTGTTTTGTTTCCACGCTGG + Intronic
1001433837 5:171684199-171684221 GTTTTCTTTTGAATTCACCATGG - Intergenic
1001495086 5:172182376-172182398 GTTTTGTTTTGTTTTGAGCCAGG + Intronic
1002157160 5:177292022-177292044 GCTCCTTTGTGATTTCACCCTGG - Exonic
1002445832 5:179289174-179289196 GCTTGGGTGTGATTTCACACGGG - Intronic
1002530409 5:179841151-179841173 GTTTTGTTTTTATTTCAGTCAGG + Intronic
1003834597 6:10057507-10057529 GCTTTGTTTTGAGGACACTCAGG + Intronic
1004261446 6:14111133-14111155 GTTTTATTTTTATTTCAGCCAGG - Intergenic
1004436688 6:15602073-15602095 GTTTTGTTTTGTTTTCAGACAGG - Intronic
1004549440 6:16632461-16632483 GTTTTGATTTGAATTCACACAGG + Intronic
1004984545 6:21066625-21066647 GTTTTGTTTTGCTTTCAGACAGG + Intronic
1005585851 6:27275832-27275854 GCTTTGATTTGAGGTCACTCTGG - Intergenic
1006632359 6:35438445-35438467 GAATTGATTTGATTTAACCCAGG - Intergenic
1006940649 6:37749979-37750001 GCTTTGTTTTGTTTTAAACCAGG + Intergenic
1008330914 6:50242844-50242866 GCTCTGTGTTCATTTAACCCTGG - Intergenic
1008686007 6:53927085-53927107 GCCTTGTCTCTATTTCACCCTGG + Intergenic
1008759367 6:54835189-54835211 GCTGTGTTTTGATTTCATTTTGG + Intergenic
1009765392 6:68067379-68067401 GCTTTATTTAGATTTTACCAAGG - Intergenic
1009792064 6:68416448-68416470 GCTTTCTTGTGAGTTCAGCCAGG + Intergenic
1010150744 6:72729311-72729333 GTTTTGTTTTTCTGTCACCCGGG + Intronic
1010663166 6:78595098-78595120 GCTTTGTTTTAATGTAACACTGG - Intergenic
1012008770 6:93753484-93753506 GATTTTTTTTTATTTTACCCAGG + Intergenic
1012457713 6:99425709-99425731 GGTTTGGTTTGGTTTGACCCTGG - Intergenic
1013142455 6:107350870-107350892 GTTTTGTTTTTTTTTCCCCCAGG - Intronic
1013144254 6:107372224-107372246 TCTTTATTTTTTTTTCACCCTGG + Intronic
1014170213 6:118270272-118270294 TCTTTGTTTTGATTTAAGTCTGG + Intronic
1014707751 6:124768725-124768747 GTTTTGTTTTTTTTTCCCCCAGG - Intronic
1015044112 6:128758935-128758957 TCTTTTTTCTGATTTCACCCTGG - Intergenic
1016212375 6:141553792-141553814 GGTTTGCTTTGACTTCAGCCAGG - Intergenic
1017294785 6:152780732-152780754 GCTTTGTTTCTATCTGACCCTGG + Intergenic
1024166856 7:46742599-46742621 GTTTTGTTTTGTTTTCTCTCAGG - Intronic
1025014134 7:55425232-55425254 GCTTTGTTTTTAATTTGCCCAGG + Exonic
1028017929 7:85738437-85738459 GCTTTGTTATGTTTTCATCAGGG + Intergenic
1029814250 7:103076892-103076914 GTTTTGTTTTGTTTTCAGACAGG + Intronic
1030235971 7:107262517-107262539 GCATTGACTTGGTTTCACCCAGG - Intronic
1030532530 7:110728914-110728936 GTTTTGTTTTGTTTTCACCCAGG + Intronic
1031877571 7:127159139-127159161 GCTTTGATTTCATCTCTCCCGGG + Intronic
1031997484 7:128242063-128242085 GCTTGGTTTGGATTTCACTGTGG + Intronic
1034639227 7:152589396-152589418 GATTTGTTCTGTTGTCACCCAGG + Intergenic
1035053050 7:156015109-156015131 GCTAGGTTTTGTTTTCTCCCTGG - Intergenic
1037106071 8:15110547-15110569 GCTTTGCTTTGATTTCACTTTGG - Intronic
1037497339 8:19452411-19452433 GCTTTTTTTTTTTTTCCCCCAGG - Intronic
1037564559 8:20106725-20106747 GCTTTGTTGTCATTTCTCCTTGG + Intergenic
1038661867 8:29504489-29504511 CCCTTGTTTTGATCTCATCCAGG + Intergenic
1040382300 8:46884724-46884746 CCCTTGATTTGATTTCACCCAGG - Intergenic
1041633532 8:60116356-60116378 GCTTTGTGTTCATTTCAAACAGG - Intergenic
1042444848 8:68871924-68871946 CTTTTGTTTTTATGTCACCCAGG + Intergenic
1044028062 8:87198345-87198367 GCGTTGTTGTTATTTGACCCTGG + Intronic
1044986460 8:97760451-97760473 GTTTTGTTTTGTTTTGACACAGG - Intergenic
1046058813 8:109111200-109111222 GCTTTGTTTTGACTTATCTCTGG - Intronic
1047357950 8:124141107-124141129 GCTTTGGTAGGATTTGACCCTGG - Intergenic
1047644202 8:126852505-126852527 GCTTGGTTTTGCTTCAACCCTGG - Intergenic
1047836119 8:128695143-128695165 GCTTTTTTCTGATTTCACTCTGG + Intergenic
1048656440 8:136542430-136542452 GTTTTGTTTTGTTTTTAACCTGG - Intergenic
1050266350 9:3894159-3894181 GCTTTGTTTGGAATTCACAAAGG - Intronic
1050360510 9:4826238-4826260 GCTTTGTTTTGTTTTGAGACAGG - Intronic
1051780125 9:20680990-20681012 GCTTTGTTTTGGTTTGAGGCAGG - Intronic
1055220941 9:73930742-73930764 GCTTTGTTCTTATTTTTCCCTGG - Intergenic
1055411814 9:76038389-76038411 GATTTGATTTGAATTCACACTGG + Intronic
1056704109 9:88937273-88937295 GCTTTGTTTTGTTTTGAGACGGG + Intergenic
1057451590 9:95167098-95167120 GTTTTGTTTTGTTTCCTCCCTGG + Intronic
1057667850 9:97060635-97060657 GTTTTGTTCTAATTTCACACTGG + Intergenic
1057883974 9:98814682-98814704 CCTTTTTTTTTTTTTCACCCAGG - Intronic
1058112454 9:101046151-101046173 GCTGTGTGTGGACTTCACCCAGG + Intronic
1059603246 9:115804291-115804313 GTTTTTGTTTGTTTTCACCCTGG - Intergenic
1059814333 9:117894550-117894572 GTTTTGTTTTGTTTTCACAGAGG + Intergenic
1060169113 9:121446256-121446278 GCTTTGTTTTGACTTCATGCTGG + Intergenic
1186700771 X:12087433-12087455 GCTCTTTGTTGATATCACCCAGG + Intergenic
1188500601 X:30821408-30821430 GCTTTGTTTTGTTTTGAGACTGG - Intergenic
1190229778 X:48573467-48573489 GTTTTGTTTTGTTTTCACCCAGG + Intergenic
1192126958 X:68510066-68510088 GCTTTCTTTAGATTTCATCCAGG + Intronic
1194510507 X:94788316-94788338 GTTTTGTTTTGTTTTGATCCAGG - Intergenic
1194554000 X:95335537-95335559 TCATTGTTTCCATTTCACCCTGG - Intergenic
1195739875 X:108052608-108052630 GTTTTGTTTTGTTTTCAGACAGG - Intronic
1196688955 X:118538507-118538529 GTTTTGTTTTGTTTTCCCCATGG + Intronic
1197310847 X:124903457-124903479 GAGTTGTTTTGATTTCTTCCAGG - Intronic
1198624018 X:138548608-138548630 GATTTTTTAGGATTTCACCCTGG - Intergenic
1199605336 X:149573720-149573742 GTTTTGTTTTGTTTTCTCCTTGG + Intergenic
1199633785 X:149795648-149795670 GTTTTGTTTTGTTTTCTCCTTGG - Intergenic
1201617006 Y:15911852-15911874 GTTTGGATTTGATTTGACCCTGG - Intergenic