ID: 944832132

View in Genome Browser
Species Human (GRCh38)
Location 2:203543400-203543422
Sequence CAGTAGGAGTTAAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944832127_944832132 21 Left 944832127 2:203543356-203543378 CCAGAGAACAACTAAATATTAAG No data
Right 944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944832132 Original CRISPR CAGTAGGAGTTAAGGGAAGA GGG Intergenic
No off target data available for this crispr