ID: 944833632

View in Genome Browser
Species Human (GRCh38)
Location 2:203557243-203557265
Sequence GGATTCCCAAATACAGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944833632_944833641 6 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833641 2:203557272-203557294 AAAAAAGGGAAGAGGTAGGTTGG No data
944833632_944833637 -8 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833637 2:203557258-203557280 GGGAATCCTGGGGAAAAAAAGGG No data
944833632_944833642 7 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833642 2:203557273-203557295 AAAAAGGGAAGAGGTAGGTTGGG No data
944833632_944833636 -9 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG No data
944833632_944833639 -2 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833639 2:203557264-203557286 CCTGGGGAAAAAAAGGGAAGAGG No data
944833632_944833640 2 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833640 2:203557268-203557290 GGGAAAAAAAGGGAAGAGGTAGG No data
944833632_944833643 15 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833643 2:203557281-203557303 AAGAGGTAGGTTGGGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944833632 Original CRISPR GGATTCCCAAATACAGATAA TGG (reversed) Intergenic
No off target data available for this crispr