ID: 944833636

View in Genome Browser
Species Human (GRCh38)
Location 2:203557257-203557279
Sequence TGGGAATCCTGGGGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944833632_944833636 -9 Left 944833632 2:203557243-203557265 CCATTATCTGTATTTGGGAATCC No data
Right 944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944833636 Original CRISPR TGGGAATCCTGGGGAAAAAA AGG Intergenic
No off target data available for this crispr