ID: 944838138

View in Genome Browser
Species Human (GRCh38)
Location 2:203599832-203599854
Sequence CAGTTAACTCATCTGCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944838135_944838138 18 Left 944838135 2:203599791-203599813 CCTCTGGGACCTGGGACAAGTCA No data
Right 944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG No data
944838136_944838138 9 Left 944838136 2:203599800-203599822 CCTGGGACAAGTCACTCGATGTA No data
Right 944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944838138 Original CRISPR CAGTTAACTCATCTGCAACA TGG Intergenic
No off target data available for this crispr