ID: 944838726

View in Genome Browser
Species Human (GRCh38)
Location 2:203605292-203605314
Sequence TCAGAGCCACCAATAAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944838726_944838732 28 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838732 2:203605343-203605365 GGCCTTGGAGACATCTTACTGGG No data
944838726_944838731 27 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838731 2:203605342-203605364 TGGCCTTGGAGACATCTTACTGG No data
944838726_944838728 -1 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838728 2:203605314-203605336 AAAATTTTTCACACTGCTGCAGG No data
944838726_944838730 13 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838730 2:203605328-203605350 TGCTGCAGGTACTTTGGCCTTGG No data
944838726_944838729 7 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838729 2:203605322-203605344 TCACACTGCTGCAGGTACTTTGG No data
944838726_944838733 29 Left 944838726 2:203605292-203605314 CCCTTCTTTATTGGTGGCTCTGA No data
Right 944838733 2:203605344-203605366 GCCTTGGAGACATCTTACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944838726 Original CRISPR TCAGAGCCACCAATAAAGAA GGG (reversed) Intergenic
No off target data available for this crispr