ID: 944847069

View in Genome Browser
Species Human (GRCh38)
Location 2:203679757-203679779
Sequence TGACCTGTGTTTACAAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944847069_944847073 13 Left 944847069 2:203679757-203679779 CCTTCATTTGTAAACACAGGTCA No data
Right 944847073 2:203679793-203679815 TTAAAATATAAAGGGGCAGATGG No data
944847069_944847071 5 Left 944847069 2:203679757-203679779 CCTTCATTTGTAAACACAGGTCA No data
Right 944847071 2:203679785-203679807 CATGCATGTTAAAATATAAAGGG No data
944847069_944847072 6 Left 944847069 2:203679757-203679779 CCTTCATTTGTAAACACAGGTCA No data
Right 944847072 2:203679786-203679808 ATGCATGTTAAAATATAAAGGGG No data
944847069_944847070 4 Left 944847069 2:203679757-203679779 CCTTCATTTGTAAACACAGGTCA No data
Right 944847070 2:203679784-203679806 TCATGCATGTTAAAATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944847069 Original CRISPR TGACCTGTGTTTACAAATGA AGG (reversed) Intergenic
No off target data available for this crispr