ID: 944848873

View in Genome Browser
Species Human (GRCh38)
Location 2:203696595-203696617
Sequence TCTTACATGCATATATTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944848871_944848873 -6 Left 944848871 2:203696578-203696600 CCGGCCACATACAGGTTTCTTAC No data
Right 944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG No data
944848866_944848873 30 Left 944848866 2:203696542-203696564 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG No data
944848872_944848873 -10 Left 944848872 2:203696582-203696604 CCACATACAGGTTTCTTACATGC No data
Right 944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG No data
944848870_944848873 -5 Left 944848870 2:203696577-203696599 CCCGGCCACATACAGGTTTCTTA No data
Right 944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG No data
944848868_944848873 3 Left 944848868 2:203696569-203696591 CCACTGTGCCCGGCCACATACAG No data
Right 944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944848873 Original CRISPR TCTTACATGCATATATTGCA TGG Intergenic
No off target data available for this crispr