ID: 944856746

View in Genome Browser
Species Human (GRCh38)
Location 2:203775490-203775512
Sequence CAGAGCAAGCTGGAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944856746_944856759 30 Left 944856746 2:203775490-203775512 CCCCCATCCTCCAGCTTGCTCTG No data
Right 944856759 2:203775543-203775565 CTAAAAGCTTCCCTTTCCTCTGG No data
944856746_944856755 1 Left 944856746 2:203775490-203775512 CCCCCATCCTCCAGCTTGCTCTG No data
Right 944856755 2:203775514-203775536 CCCCAGGTGGCTCTCCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944856746 Original CRISPR CAGAGCAAGCTGGAGGATGG GGG (reversed) Intergenic
No off target data available for this crispr