ID: 944861561

View in Genome Browser
Species Human (GRCh38)
Location 2:203819979-203820001
Sequence CACAATGGGGTGGAGAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944861554_944861561 12 Left 944861554 2:203819944-203819966 CCGGGATTTCTTGGTGGAACAAG No data
Right 944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG No data
944861551_944861561 28 Left 944861551 2:203819928-203819950 CCGCAGCAGAGCTCGTCCGGGAT No data
Right 944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944861561 Original CRISPR CACAATGGGGTGGAGAAGGC GGG Intergenic
No off target data available for this crispr