ID: 944862079 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:203824695-203824717 |
Sequence | GGATATACAGACGTGGAGCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
944862077_944862079 | -10 | Left | 944862077 | 2:203824682-203824704 | CCAAGAGGTAGTGGGATATACAG | No data | ||
Right | 944862079 | 2:203824695-203824717 | GGATATACAGACGTGGAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
944862079 | Original CRISPR | GGATATACAGACGTGGAGCT AGG | Intergenic | ||
No off target data available for this crispr |