ID: 944862079

View in Genome Browser
Species Human (GRCh38)
Location 2:203824695-203824717
Sequence GGATATACAGACGTGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944862077_944862079 -10 Left 944862077 2:203824682-203824704 CCAAGAGGTAGTGGGATATACAG No data
Right 944862079 2:203824695-203824717 GGATATACAGACGTGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944862079 Original CRISPR GGATATACAGACGTGGAGCT AGG Intergenic
No off target data available for this crispr