ID: 944863284

View in Genome Browser
Species Human (GRCh38)
Location 2:203835825-203835847
Sequence ATCTGTGTTAGTATTGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944863284_944863290 22 Left 944863284 2:203835825-203835847 CCGGCTTCAATACTAACACAGAT No data
Right 944863290 2:203835870-203835892 GATTGTGCGCCACTCAGCCCGGG No data
944863284_944863289 21 Left 944863284 2:203835825-203835847 CCGGCTTCAATACTAACACAGAT No data
Right 944863289 2:203835869-203835891 TGATTGTGCGCCACTCAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944863284 Original CRISPR ATCTGTGTTAGTATTGAAGC CGG (reversed) Intergenic
No off target data available for this crispr