ID: 944863379

View in Genome Browser
Species Human (GRCh38)
Location 2:203836752-203836774
Sequence TGAATTTGGACAAGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944863376_944863379 -3 Left 944863376 2:203836732-203836754 CCAAAGCTCTGGAGTAGGGATGA No data
Right 944863379 2:203836752-203836774 TGAATTTGGACAAGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944863379 Original CRISPR TGAATTTGGACAAGTGTGGC TGG Intergenic
No off target data available for this crispr