ID: 944864437

View in Genome Browser
Species Human (GRCh38)
Location 2:203846923-203846945
Sequence AACATTTAGCAATTTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944864437_944864441 8 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864441 2:203846954-203846976 GGTGGCCTGTGAAAATGTTCAGG No data
944864437_944864446 30 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864446 2:203846976-203846998 GTGGAGGGTAGTAGTGAGTAAGG No data
944864437_944864444 14 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864444 2:203846960-203846982 CTGTGAAAATGTTCAGGTGGAGG No data
944864437_944864445 15 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864445 2:203846961-203846983 TGTGAAAATGTTCAGGTGGAGGG No data
944864437_944864442 11 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864442 2:203846957-203846979 GGCCTGTGAAAATGTTCAGGTGG No data
944864437_944864439 -10 Left 944864437 2:203846923-203846945 CCTGGCACAAATTGCTAAATGTT No data
Right 944864439 2:203846936-203846958 GCTAAATGTTTCACCACTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944864437 Original CRISPR AACATTTAGCAATTTGTGCC AGG (reversed) Intergenic
No off target data available for this crispr