ID: 944867210

View in Genome Browser
Species Human (GRCh38)
Location 2:203874394-203874416
Sequence TAGTTCATTTGGAAGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944867210_944867216 10 Left 944867210 2:203874394-203874416 CCCTGTGGCTTCCAAATGAACTA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 944867216 2:203874427-203874449 GTGGGGAAAACACACACCTGTGG 0: 1
1: 0
2: 3
3: 29
4: 245
944867210_944867214 -8 Left 944867210 2:203874394-203874416 CCCTGTGGCTTCCAAATGAACTA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 944867214 2:203874409-203874431 ATGAACTATTTTGCAAATGTGGG 0: 1
1: 0
2: 2
3: 35
4: 344
944867210_944867213 -9 Left 944867210 2:203874394-203874416 CCCTGTGGCTTCCAAATGAACTA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 944867213 2:203874408-203874430 AATGAACTATTTTGCAAATGTGG 0: 1
1: 0
2: 3
3: 42
4: 447
944867210_944867215 -7 Left 944867210 2:203874394-203874416 CCCTGTGGCTTCCAAATGAACTA 0: 1
1: 0
2: 1
3: 16
4: 159
Right 944867215 2:203874410-203874432 TGAACTATTTTGCAAATGTGGGG 0: 1
1: 0
2: 4
3: 30
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944867210 Original CRISPR TAGTTCATTTGGAAGCCACA GGG (reversed) Intergenic
902329375 1:15723799-15723821 TAGTGCCCTTGGAAGCCACAGGG - Intronic
904360217 1:29966277-29966299 TAGTTCAATGAGCAGCCACATGG + Intergenic
909297182 1:73965702-73965724 TATTTCATATGGAACCCAAAAGG - Intergenic
909484116 1:76154893-76154915 TAGGTCATCTGGCAGCCACTGGG + Intronic
909676413 1:78243259-78243281 TGGTTTATTTGGAACCCACTGGG + Intergenic
910143425 1:84052181-84052203 TATCTCATTTTGAAGCTACAAGG + Intergenic
912366279 1:109136418-109136440 TGGTTCCTTCGGAAGCCACAAGG - Intronic
916023960 1:160818292-160818314 TGGTGCATTTGGAAGCGAAAAGG + Exonic
917496748 1:175547267-175547289 TGGGTCATGTTGAAGCCACATGG + Intronic
918205498 1:182304821-182304843 TAGTACATTTCAAAGCCACAAGG - Intergenic
920843199 1:209572120-209572142 AAGTTCATTTGGCAGCAAAACGG + Intergenic
921267752 1:213439161-213439183 TAGAGCATTTGGAAACCCCATGG - Intergenic
1064640449 10:17409989-17410011 TAATTAATGTGGAAGCCCCAGGG + Intronic
1064701631 10:18027801-18027823 TTGCTCATTTGTAAGCCAAATGG + Intronic
1066240942 10:33534295-33534317 TAGTTCATTTTCAAGCCTCTAGG + Intergenic
1066324864 10:34348211-34348233 TAGTTCATTTGGTACCCAGTTGG - Intronic
1069925017 10:71843374-71843396 TAGTGCTATAGGAAGCCACATGG + Intronic
1072447096 10:95508713-95508735 TAGAGCAGTTGGAAGCCACACGG - Intronic
1075571361 10:123548676-123548698 TAGTTCCTCTGGAACCCACCAGG - Intergenic
1076039105 10:127227680-127227702 TAGTTAGTGGGGAAGCCACAGGG + Intronic
1078398002 11:10999169-10999191 TTGTTCATTTGGAACCCAGTGGG - Intergenic
1081044450 11:38253869-38253891 AGGTTCTTTTGGAAGCTACAAGG - Intergenic
1085805092 11:79628608-79628630 TAGTATATTTTGAAGCCACGTGG + Intergenic
1086295167 11:85358334-85358356 TATTTAAGTTGAAAGCCACATGG - Intronic
1086850626 11:91803165-91803187 AAGTTCATTTGGAATTCAGAAGG + Intergenic
1092745486 12:11668742-11668764 TTGTGCAATAGGAAGCCACAGGG - Intronic
1093117168 12:15225447-15225469 TATTTCATTTTGAAGTTACATGG + Intronic
1094459447 12:30678705-30678727 AAGTGCATTTGGAAGCCATTTGG + Intronic
1095260062 12:40087467-40087489 AAGGTTATTTGAAAGCCACAGGG - Intronic
1096060150 12:48691321-48691343 TTTTTCATTTGGAAGTCATAGGG - Exonic
1096665272 12:53160168-53160190 TGGCTCATGTGGAAGGCACAGGG - Exonic
1098078786 12:66761270-66761292 TACTTAATTTGGAAGACACAAGG - Intronic
1098232364 12:68385005-68385027 TATTTCACTTGGAAGACTCATGG - Intergenic
1099040739 12:77651469-77651491 TAGATCATTTAATAGCCACAGGG + Intergenic
1106123373 13:26880584-26880606 TAGGTCATGGGAAAGCCACATGG - Intergenic
1106550913 13:30769873-30769895 CAGTGCATTAGGAAGCCCCATGG - Intergenic
1107206385 13:37794841-37794863 TAGTTTCTTTGGAAACCTCATGG - Intronic
1108110724 13:47069018-47069040 TAGTTTATTTGGGAGATACAAGG + Intergenic
1111812244 13:93105589-93105611 TAGTTCATTTGAAAACAAAAAGG - Intergenic
1113100463 13:106712218-106712240 TAGATTATGTGGAAGTCACAGGG + Intergenic
1114566781 14:23639047-23639069 GAGTCCTTGTGGAAGCCACAAGG - Intronic
1114619798 14:24088517-24088539 TATTTTATTTGGAATCCTCAGGG - Intronic
1116115592 14:40645563-40645585 TTGTTCCTCTGGAAGGCACAGGG - Intergenic
1120191115 14:81440562-81440584 TATTTAATATGGAAGCCACTAGG + Intergenic
1122999904 14:105287786-105287808 AAGTTCAGTTGGAAGCAAAAAGG + Intronic
1126985670 15:54304538-54304560 TAGGTCATTTGGAATCTGCAAGG - Intronic
1129749719 15:78053294-78053316 TAGTATTTTTGGAAGACACACGG - Intronic
1129769833 15:78195880-78195902 TAGTTCATTTGTCTGCCTCAGGG - Intronic
1132261818 15:100432441-100432463 TAGTTCATGTGGAAAAGACATGG + Intronic
1132797752 16:1733659-1733681 GAGTTCAGTGGGAAGCCCCATGG + Intronic
1135380687 16:21993912-21993934 CAGTACTTTTGGAGGCCACATGG + Intronic
1136513630 16:30754679-30754701 AAGTACATGTGGAAGCCAAAGGG - Intronic
1144236840 17:13269833-13269855 TTGTCCATGTGGAAGGCACAAGG - Intergenic
1145768377 17:27475126-27475148 GAGCTCATGTGGAAGCCAAAGGG + Intronic
1148351101 17:46942824-46942846 CATTTCATATGGAAGGCACATGG + Intronic
1148773315 17:50079278-50079300 TATTTCATTTGCATGCTACAGGG + Intronic
1149641284 17:58204559-58204581 TAGCACATTGGGAAGCCACTTGG - Intronic
1150660151 17:67068204-67068226 TGGTTGATTTGAAATCCACAAGG - Intergenic
1152379968 17:79937296-79937318 CAGCTCTTTTGGAGGCCACAGGG - Exonic
1153823336 18:8851726-8851748 TAGTTCATATGGAAGCCAACAGG - Intergenic
1157180158 18:45490128-45490150 AAATTCATTTGAAAGCCAAAGGG + Intronic
1163497869 19:17657086-17657108 TGCTTCCCTTGGAAGCCACAGGG + Intronic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165010623 19:32843767-32843789 TGGGTCATTTGGAAGCCGCCGGG + Intronic
1168536468 19:57174285-57174307 TAATTATTTTAGAAGCCACATGG + Intergenic
926106436 2:10155072-10155094 CAATTCAGTTGGAAGCAACATGG - Intronic
926621503 2:15050371-15050393 TATTTAACTTTGAAGCCACAAGG - Intergenic
926812839 2:16771706-16771728 TAGTGCATTTAGAGGCCACGTGG - Intergenic
928364366 2:30690066-30690088 GAGTTCATCTGGAATCCCCAAGG + Intergenic
929886710 2:45885274-45885296 CATTTTATTTGGAAGTCACATGG - Intronic
931595245 2:63934966-63934988 TAGTTTTTTTGGAATCTACATGG + Intronic
933436790 2:82259640-82259662 TATTTGATTTGGAAGCCAGCTGG + Intergenic
934606261 2:95697787-95697809 TTCTTCATAGGGAAGCCACATGG + Intergenic
936539666 2:113340003-113340025 TTCTTCATAGGGAAGCCACATGG + Intergenic
936863521 2:117051261-117051283 ATGTTCAGATGGAAGCCACAGGG - Intergenic
937173069 2:119896730-119896752 TAGTTCATATAGAAAACACATGG + Intronic
937292921 2:120792928-120792950 TAGATTATTTGGAAGCCAGAAGG + Intronic
938650054 2:133373645-133373667 TAGTGCATTTTGAAGTCAGACGG - Intronic
938834373 2:135084672-135084694 TAGTACCTTTGGAAGTTACAGGG + Intronic
939647097 2:144713786-144713808 TTGTACCTTTGAAAGCCACATGG + Intergenic
940765152 2:157782287-157782309 TAGTTCCTTTGAAAACCACAAGG + Intronic
941275334 2:163483914-163483936 TAGTTCATCTGCAAGGCTCATGG + Intergenic
943484872 2:188466224-188466246 TACTTCATTTGGATACCAGAAGG + Intronic
944867210 2:203874394-203874416 TAGTTCATTTGGAAGCCACAGGG - Intergenic
944868527 2:203885728-203885750 TAGTTCATTTCCAAGACACAGGG - Intergenic
948885262 2:240879036-240879058 CAGCTCATTTGGAAGGCACTGGG - Exonic
1173571302 20:44078209-44078231 TAGTTCACTGGGAGGACACAGGG - Intergenic
1174904903 20:54540113-54540135 AAGTCCCTTTGGAAGCCCCAGGG + Intronic
1178152588 21:29812673-29812695 TAGCTCATTGTGAAGCCACTAGG + Intronic
1179330189 21:40392850-40392872 GAGCTCCTTAGGAAGCCACAAGG + Intronic
949206857 3:1450590-1450612 TAGTTAATTTGGAAGCAACCTGG - Intergenic
950053248 3:10007756-10007778 AAGCTCATTAGGAACCCACAAGG - Intronic
954066788 3:48113105-48113127 TACTTCATATGCAAGCCATATGG + Intergenic
954096995 3:48336386-48336408 TTGTATATTTGAAAGCCACATGG + Intergenic
955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG + Intronic
956324270 3:68033914-68033936 CAGTTCATTTGGAAGAAATATGG + Intronic
960485555 3:118248666-118248688 TAGTTCTTTTAGTGGCCACATGG + Intergenic
962586233 3:136845004-136845026 TAGTTAATATGGAACCAACAAGG - Intronic
962961314 3:140313948-140313970 CAGTTCCTCTGGTAGCCACAAGG + Intronic
963967879 3:151393547-151393569 TAAATCTTTTGGAACCCACAAGG + Intronic
967141535 3:186565841-186565863 AAAATCATTTGGAAGCAACAAGG - Intronic
969539262 4:7776206-7776228 TACTTCAGGTAGAAGCCACAGGG + Intronic
972582876 4:40410551-40410573 TAGTACTTTGGGAAGCCAAAGGG - Intergenic
973723959 4:53753827-53753849 TAGGACATTAGGAAGCCATATGG + Intronic
973878470 4:55244550-55244572 AAGTTACTCTGGAAGCCACAGGG + Intergenic
978953770 4:114592205-114592227 TACTTCTTTTGGAACCCATACGG + Intergenic
979473393 4:121126831-121126853 AAGTACATTAGGAAGCCCCAAGG + Intergenic
979732906 4:124045785-124045807 TGGCTCACTTGGGAGCCACACGG - Intergenic
980836611 4:138201705-138201727 TAGTTCATTTGTCACCCATAGGG - Intronic
982172696 4:152677186-152677208 TAATTCACTTGGAAGTCACCAGG - Intronic
984845633 4:184105997-184106019 AAGTTCAGTGGGAAACCACAGGG - Intronic
985747769 5:1656815-1656837 TAGTTGTTATGGCAGCCACAGGG - Intergenic
986413747 5:7507617-7507639 AAGTTTATTTGGAAGCAACGAGG - Intronic
986802012 5:11270849-11270871 TAGTTCATGTGAATGCCACGTGG + Intronic
988785225 5:34560532-34560554 GTGTTCATTTGGAAGAAACAGGG - Intergenic
988884437 5:35539977-35539999 TAGTTCTCCTGGAGGCCACAGGG + Intergenic
990608851 5:57437627-57437649 AAGTTCATCTTGAAGCCACCAGG + Intergenic
993218402 5:85057002-85057024 TAGTTCATTTGGAAGTTCCATGG + Intergenic
993741686 5:91549344-91549366 AAATTCATATGGAAGCCAAAAGG + Intergenic
993768945 5:91900480-91900502 TAGATCATATGGAAGCAACAGGG + Intergenic
996603459 5:125293185-125293207 GAGTTCAATAGGAAGCCAGAGGG + Intergenic
1001259581 5:170216358-170216380 CAGTTCACTTGGAAGCTAAAAGG - Intergenic
1001954470 5:175838812-175838834 CATTTGATTTGGAAGCCAAATGG - Intronic
1001954899 5:175842528-175842550 GAGTTCACTGGGAAGACACATGG + Intronic
1003154769 6:3582222-3582244 TGGTTTATTTGAAAGGCACATGG - Intergenic
1009506983 6:64496414-64496436 TAGTTAATTTTTAAGGCACAAGG + Intronic
1010115860 6:72309540-72309562 TAGGTAAATTGAAAGCCACATGG - Intronic
1011428221 6:87253899-87253921 TAAGTCATTTGAAAGACACATGG - Intronic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1014402854 6:121012620-121012642 GAATTCAGTTGAAAGCCACATGG + Intergenic
1022423721 7:30247684-30247706 CAGTACATTTAGAAGCCAAATGG + Intergenic
1022609421 7:31854313-31854335 TAGTTAATTTGGAAGAGGCAAGG - Intronic
1023257653 7:38328092-38328114 TATTTCATTTGGAACCCATATGG - Intergenic
1023665842 7:42522464-42522486 TGGTTCATTTCGCAACCACAAGG + Intergenic
1027565057 7:79780982-79781004 AACTTTATTTGGAAGCCCCAAGG - Intergenic
1029021043 7:97364808-97364830 TGGTCCATTTGGCAGCCAGAGGG + Intergenic
1030143454 7:106329042-106329064 TAGTTAATTTGGAATCCCAAGGG - Intergenic
1032067588 7:128783256-128783278 TAGCTCATTGCGGAGCCACACGG - Intergenic
1033020077 7:137715663-137715685 TTGTTCATTTGCATGCTACAGGG - Intronic
1036781065 8:11648012-11648034 TGTTTCATATAGAAGCCACAGGG + Intergenic
1037255691 8:16950058-16950080 TATTTTATTTGCAAGCCTCATGG + Intergenic
1039166916 8:34692149-34692171 TAGCTCATTGAAAAGCCACATGG + Intergenic
1040486016 8:47872232-47872254 TATATCATTTGCAAGCCTCACGG + Intronic
1042299831 8:67265601-67265623 TAGTACATTTGTAAGCCAGCTGG + Intronic
1042567014 8:70121962-70121984 TGGTTAATTTGGAAGCCCCAAGG - Intronic
1043931607 8:86098102-86098124 CAGTTCATTTGTAAGACAAATGG - Intronic
1045227318 8:100261657-100261679 GAGTGCAAGTGGAAGCCACATGG - Exonic
1045562758 8:103281753-103281775 TTGTTCACTTGGCAGCCTCAGGG - Intergenic
1046425558 8:114043704-114043726 AAGTTCATATGGAAGCAAAAAGG - Intergenic
1046753726 8:117952113-117952135 TAGTTCTTTTGGAAGCCACTAGG - Intronic
1047055850 8:121164409-121164431 TGCTTCAGTTGGAAGCCACCTGG + Intergenic
1047865138 8:129015231-129015253 TAGTTCAGTTGGAAGTCAGGTGG + Intergenic
1048555641 8:135473259-135473281 AAGTCAATTTGGAAGCCACGTGG - Intronic
1051979122 9:22992064-22992086 TAATTAAATTGGAGGCCACAGGG - Intergenic
1053869492 9:42475754-42475776 TAGTTTATTTGTTAGCCACTCGG - Intergenic
1054242063 9:62624688-62624710 TAGTTTATTTGTTAGCCACTCGG + Intergenic
1054556188 9:66659204-66659226 TAGTTTATTTGTTAGCCACTCGG + Intergenic
1056237061 9:84605153-84605175 TTGTTCTTTAGGAGGCCACATGG + Intergenic
1057963346 9:99478378-99478400 TATTTCATTAGAAAGCAACATGG + Intergenic
1058924504 9:109649234-109649256 TTCTTCAATTGAAAGCCACAGGG - Intronic
1059233570 9:112743227-112743249 GAGTTCATCTGCAAGTCACAGGG + Intergenic
1060505110 9:124191904-124191926 TAGTCCATTGGGAAGCCAATGGG - Intergenic
1186432068 X:9513490-9513512 TCGTCCACTTGGAATCCACATGG + Intronic
1186526998 X:10257921-10257943 TAGTTTATTTGGGAGCAGCACGG + Intergenic
1187085202 X:16035364-16035386 TATTTGATTTGGAAGAAACATGG + Intergenic
1187760244 X:22575483-22575505 TAGTTGATAAGGCAGCCACAAGG + Intergenic
1188699272 X:33237998-33238020 AAATTCATTTGGAAGTGACAGGG - Intronic
1189051085 X:37646453-37646475 TAGTTCACTTGGAATCCACTAGG - Intronic
1189698670 X:43693726-43693748 TAATGCATTTGAAGGCCACAGGG + Intronic
1190357523 X:49619491-49619513 CAGTTCAGTTGGGAGTCACAGGG - Intergenic
1190383120 X:49858698-49858720 TTGTTCTTTTGGAAGCCCAAAGG + Intergenic
1198077141 X:133204576-133204598 TGGTTCAGTTGGCAGCAACACGG + Intergenic
1198607064 X:138352608-138352630 TAGTTCATCTATAAGGCACAGGG - Intergenic
1202271226 Y:23076431-23076453 TTGATCATTTGGAGGCCACCTGG - Intergenic
1202294800 Y:23344251-23344273 TTGATCATTTGGAGGCCACCTGG + Intergenic
1202424221 Y:24710175-24710197 TTGATCATTTGGAGGCCACCTGG - Intergenic
1202446568 Y:24959910-24959932 TTGATCATTTGGAGGCCACCTGG + Intergenic