ID: 944868159

View in Genome Browser
Species Human (GRCh38)
Location 2:203882453-203882475
Sequence TTGTATTTTTCATGGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944868159_944868167 15 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868167 2:203882491-203882513 GGGGGCATGCGCCAGCAACTCGG No data
944868159_944868169 19 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data
944868159_944868173 29 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868173 2:203882505-203882527 GCAACTCGGGAGGCTGAGGTGGG 0: 56
1: 7191
2: 131371
3: 325560
4: 350219
944868159_944868170 25 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868170 2:203882501-203882523 GCCAGCAACTCGGGAGGCTGAGG 0: 6
1: 1320
2: 109073
3: 302452
4: 335951
944868159_944868164 -5 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868164 2:203882471-203882493 TACAAAAATTAGCTAGGTGTGGG 0: 18
1: 389
2: 1113
3: 2013
4: 2625
944868159_944868168 16 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868168 2:203882492-203882514 GGGGCATGCGCCAGCAACTCGGG No data
944868159_944868165 -4 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868165 2:203882472-203882494 ACAAAAATTAGCTAGGTGTGGGG 0: 16
1: 398
2: 1014
3: 2149
4: 3043
944868159_944868163 -6 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868163 2:203882470-203882492 ATACAAAAATTAGCTAGGTGTGG 0: 934
1: 34361
2: 77611
3: 121426
4: 116848
944868159_944868172 28 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868172 2:203882504-203882526 AGCAACTCGGGAGGCTGAGGTGG 0: 68
1: 6782
2: 40359
3: 120792
4: 196115
944868159_944868166 -3 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868166 2:203882473-203882495 CAAAAATTAGCTAGGTGTGGGGG 0: 914
1: 35013
2: 98387
3: 181534
4: 206563

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944868159 Original CRISPR TTGTATTTTTCATGGAGACA GGG (reversed) Intergenic
No off target data available for this crispr