ID: 944868160

View in Genome Browser
Species Human (GRCh38)
Location 2:203882454-203882476
Sequence TTTGTATTTTTCATGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432933
Summary {0: 14, 1: 674, 2: 13995, 3: 196377, 4: 221873}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944868160_944868163 -7 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868163 2:203882470-203882492 ATACAAAAATTAGCTAGGTGTGG 0: 934
1: 34361
2: 77611
3: 121426
4: 116848
944868160_944868165 -5 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868165 2:203882472-203882494 ACAAAAATTAGCTAGGTGTGGGG 0: 16
1: 398
2: 1014
3: 2149
4: 3043
944868160_944868173 28 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868173 2:203882505-203882527 GCAACTCGGGAGGCTGAGGTGGG 0: 56
1: 7191
2: 131371
3: 325560
4: 350219
944868160_944868168 15 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868168 2:203882492-203882514 GGGGCATGCGCCAGCAACTCGGG No data
944868160_944868167 14 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868167 2:203882491-203882513 GGGGGCATGCGCCAGCAACTCGG No data
944868160_944868172 27 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868172 2:203882504-203882526 AGCAACTCGGGAGGCTGAGGTGG 0: 68
1: 6782
2: 40359
3: 120792
4: 196115
944868160_944868169 18 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data
944868160_944868166 -4 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868166 2:203882473-203882495 CAAAAATTAGCTAGGTGTGGGGG 0: 914
1: 35013
2: 98387
3: 181534
4: 206563
944868160_944868170 24 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868170 2:203882501-203882523 GCCAGCAACTCGGGAGGCTGAGG 0: 6
1: 1320
2: 109073
3: 302452
4: 335951
944868160_944868164 -6 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868164 2:203882471-203882493 TACAAAAATTAGCTAGGTGTGGG 0: 18
1: 389
2: 1113
3: 2013
4: 2625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944868160 Original CRISPR TTTGTATTTTTCATGGAGAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr