ID: 944868161

View in Genome Browser
Species Human (GRCh38)
Location 2:203882461-203882483
Sequence GCTAATTTTTGTATTTTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 13012
Summary {0: 19, 1: 323, 2: 5188, 3: 4341, 4: 3141}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944868161_944868174 24 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868174 2:203882508-203882530 ACTCGGGAGGCTGAGGTGGGAGG 0: 2427
1: 22969
2: 41666
3: 78900
4: 130303
944868161_944868170 17 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868170 2:203882501-203882523 GCCAGCAACTCGGGAGGCTGAGG 0: 6
1: 1320
2: 109073
3: 302452
4: 335951
944868161_944868172 20 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868172 2:203882504-203882526 AGCAACTCGGGAGGCTGAGGTGG 0: 68
1: 6782
2: 40359
3: 120792
4: 196115
944868161_944868167 7 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868167 2:203882491-203882513 GGGGGCATGCGCCAGCAACTCGG No data
944868161_944868173 21 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868173 2:203882505-203882527 GCAACTCGGGAGGCTGAGGTGGG 0: 56
1: 7191
2: 131371
3: 325560
4: 350219
944868161_944868168 8 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868168 2:203882492-203882514 GGGGCATGCGCCAGCAACTCGGG No data
944868161_944868169 11 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944868161 Original CRISPR GCTAATTTTTGTATTTTTCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr