ID: 944868169

View in Genome Browser
Species Human (GRCh38)
Location 2:203882495-203882517
Sequence GCATGCGCCAGCAACTCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944868159_944868169 19 Left 944868159 2:203882453-203882475 CCCTGTCTCCATGAAAAATACAA No data
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data
944868161_944868169 11 Left 944868161 2:203882461-203882483 CCATGAAAAATACAAAAATTAGC 0: 19
1: 323
2: 5188
3: 4341
4: 3141
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data
944868160_944868169 18 Left 944868160 2:203882454-203882476 CCTGTCTCCATGAAAAATACAAA 0: 14
1: 674
2: 13995
3: 196377
4: 221873
Right 944868169 2:203882495-203882517 GCATGCGCCAGCAACTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944868169 Original CRISPR GCATGCGCCAGCAACTCGGG AGG Intergenic
No off target data available for this crispr