ID: 944873118

View in Genome Browser
Species Human (GRCh38)
Location 2:203933945-203933967
Sequence GGTGAAGCCTAGATATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944873112_944873118 3 Left 944873112 2:203933919-203933941 CCTTTCAGAATGGCAAACCAAGC No data
Right 944873118 2:203933945-203933967 GGTGAAGCCTAGATATTTGGGGG No data
944873111_944873118 4 Left 944873111 2:203933918-203933940 CCCTTTCAGAATGGCAAACCAAG No data
Right 944873118 2:203933945-203933967 GGTGAAGCCTAGATATTTGGGGG No data
944873109_944873118 25 Left 944873109 2:203933897-203933919 CCTCTCACTTTTGATGCTTGTCC No data
Right 944873118 2:203933945-203933967 GGTGAAGCCTAGATATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944873118 Original CRISPR GGTGAAGCCTAGATATTTGG GGG Intergenic
No off target data available for this crispr