ID: 944875581

View in Genome Browser
Species Human (GRCh38)
Location 2:203961375-203961397
Sequence GGCCAGGTGGGCCACCATGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944875581_944875590 23 Left 944875581 2:203961375-203961397 CCTTCATGGTGGCCCACCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 258
Right 944875590 2:203961421-203961443 CACATCCTCATCCCCAGCATGGG 0: 1
1: 0
2: 2
3: 31
4: 273
944875581_944875589 22 Left 944875581 2:203961375-203961397 CCTTCATGGTGGCCCACCTGGCC 0: 1
1: 0
2: 3
3: 19
4: 258
Right 944875589 2:203961420-203961442 ACACATCCTCATCCCCAGCATGG 0: 1
1: 0
2: 2
3: 23
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944875581 Original CRISPR GGCCAGGTGGGCCACCATGA AGG (reversed) Exonic
900397542 1:2459356-2459378 GGCAAGGAGGACCACCAGGAAGG - Intronic
900397556 1:2459404-2459426 GGCAAGGAGGACCACCAGGAAGG - Intronic
900397600 1:2459548-2459570 GGCAAGGAGGACCACCAGGAAGG - Intronic
900608646 1:3535167-3535189 GGCCAGGTGTGTCACCGCGACGG + Intronic
900611601 1:3546751-3546773 TGCCAGGGAGGCCACCATGGCGG + Intronic
901842886 1:11964857-11964879 GACAAGGCGGCCCACCATGAGGG - Intronic
902932403 1:19740799-19740821 GGCCTCCTGGGCCACCATGTTGG + Exonic
904211219 1:28887760-28887782 GGCCGGGGGGGCCACCCTGGCGG - Intronic
904774273 1:32897072-32897094 GGCGAGGAGGTCCACCAGGATGG - Intronic
905697772 1:39988160-39988182 GGCCTGAGGGGCCAACATGAGGG + Intergenic
906581057 1:46935437-46935459 GGGCAGGTGGGGCAGCGTGAAGG - Intronic
906602667 1:47143457-47143479 GGGCAGGTGGGGCAGCGTGAAGG + Intronic
906645584 1:47472171-47472193 GGCCTGCTGGGTCACCAGGAGGG + Intergenic
909926090 1:81439615-81439637 GGCCAGGTGTGTCGCCTTGAGGG + Intronic
911070331 1:93827205-93827227 GGCCAGCTGTGCCATCATGAAGG + Intronic
915201706 1:154234709-154234731 GACGTGGTGGGCCACCAAGACGG + Exonic
915270125 1:154747885-154747907 GGGCAGAGGGGCCAGCATGAGGG - Intronic
915581710 1:156816691-156816713 GGCCAGGGGGAACTCCATGAGGG + Exonic
916745779 1:167683943-167683965 GGCCAGCTGGGCCACCGAGGGGG - Exonic
917637525 1:176951306-176951328 GGCCAGATGTGCCACCAGAAGGG + Intronic
919780733 1:201219129-201219151 GGGCAGGTGGGCCAGCTTGGGGG - Intronic
920500638 1:206482937-206482959 GGAGAGGTGGGTCACCAGGATGG - Intronic
921800751 1:219399603-219399625 GGCTATGGGGGCCACCCTGATGG + Intergenic
924036730 1:239945479-239945501 GGGCAGGTGGGACACCATTCAGG - Intergenic
924042016 1:239992960-239992982 GGGCAGGTGGGACACCATTCAGG + Intergenic
924331667 1:242946230-242946252 GGCCATGGGGGCCACCCTGCTGG - Intergenic
1063355401 10:5394213-5394235 GGCCTCGTTGTCCACCATGAAGG + Exonic
1063362633 10:5470225-5470247 GCCCAGGAGGGCCTCCGTGAGGG - Intergenic
1063580684 10:7304031-7304053 GGCGAGGTGGGCCACGGAGATGG + Intronic
1065537734 10:26731141-26731163 GGCCAGGCCGGCCAACATGGTGG + Intronic
1065794490 10:29293326-29293348 GCCCAGGTGGGACCCCATAACGG - Intronic
1068837479 10:61570345-61570367 GGCAAGGTGAGCTACCATAATGG - Intergenic
1069512287 10:69051451-69051473 GACCACGGGGGCCACGATGAGGG - Intergenic
1069900631 10:71704883-71704905 GGCAAGGAGGGGCAGCATGAGGG - Intronic
1073321176 10:102617150-102617172 GGGCAGGTGGGCAGCCAGGAGGG + Intronic
1074469649 10:113715399-113715421 GGCCAGCAGGGACACCCTGAAGG + Intronic
1075675780 10:124294912-124294934 GCACAGGTGGGCCCCCATGCAGG + Intergenic
1076536589 10:131181688-131181710 GGCCAGGTGGGCCAGGAGCAGGG + Intronic
1077144050 11:1036964-1036986 GGCCAGGATGGCCCCCATGCAGG - Intergenic
1077319998 11:1936835-1936857 GGGCTGCTGGGCCCCCATGAGGG - Intronic
1077394261 11:2313411-2313433 GGGCAGGAGGGCCACTCTGACGG + Intronic
1077607314 11:3620923-3620945 GGCCAGGGGAGCCATTATGAAGG - Intergenic
1077664701 11:4097085-4097107 GACCAGCTGGGCCAACATGGTGG + Intronic
1078484400 11:11708087-11708109 GGACAGGTGGGCTTCCATGATGG + Intergenic
1081716975 11:45257434-45257456 GGCCAGGAGGGCTAGCATGGAGG - Intronic
1083686809 11:64381420-64381442 GGCCAGGAGGGCCCCCATCATGG + Intergenic
1083817445 11:65143465-65143487 GGCCAGGATGGTCACCATGTTGG + Intergenic
1083904545 11:65661650-65661672 GGCTAGGAGGCCCAGCATGAGGG - Intronic
1084874004 11:72117316-72117338 GTCCAGGGAGGCCACAATGATGG - Intronic
1085384724 11:76150408-76150430 GGGCAGAAGGGGCACCATGAAGG + Intergenic
1085781403 11:79412300-79412322 ACCCAGCTGGGCCATCATGAGGG - Intronic
1086942879 11:92816475-92816497 GTGCAGGTGGGCCAGCCTGAGGG - Intronic
1087169605 11:95037633-95037655 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1087172739 11:95067270-95067292 GGTCAGGTTGTCCACCTTGAGGG - Exonic
1091387576 12:104656-104678 AGCCACGTGGGCCACCAGGGCGG - Intronic
1091772785 12:3164008-3164030 GGGCAGGAGGGCCAGCAGGAGGG + Intronic
1092213989 12:6667723-6667745 GGCCAGGTGCTCCACCTGGATGG + Exonic
1096244251 12:49975481-49975503 GGCCAGGAGGGCTCCCATCAGGG - Exonic
1104076117 12:125391577-125391599 GGCCATGGGAGCCACCATGTGGG + Intronic
1104838867 12:131810801-131810823 GGCCAGGTCAGCCCCCAAGAAGG + Intergenic
1104918974 12:132280731-132280753 GGGCTGGGGGGCCACCCTGAGGG - Intronic
1105682657 13:22745154-22745176 GGCCTGGTGTGCCAGCATGCCGG + Intergenic
1106798715 13:33233808-33233830 GACCAGGTGTGTCACCTTGAGGG - Intronic
1107707435 13:43121836-43121858 TGCCAGGTGGGTCACCAGGCTGG - Intergenic
1108642272 13:52394193-52394215 GGGCAGGAGGGCCACCTTGGTGG - Intronic
1111960516 13:94804919-94804941 GGCCAAGTAGTCCACCATGTTGG - Intergenic
1113572306 13:111367004-111367026 GACCGGCTGGGCCACCATGGTGG - Intergenic
1113629854 13:111874737-111874759 GGCCAGGTGGTCCAGAAAGATGG - Intergenic
1113772230 13:112917579-112917601 GGCCAGGTGGGCCACCGGAGGGG - Intronic
1114452809 14:22837786-22837808 GGCCCGGTGGGCCACCGTCTGGG - Intronic
1114538538 14:23438159-23438181 GGCCAGGGGCCCCACCATGCTGG + Intergenic
1114929112 14:27445288-27445310 GCCCAGGCGAGCAACCATGATGG - Intergenic
1115157986 14:30361786-30361808 GGCCAGGTAGGACACCTTGGGGG - Intergenic
1119808905 14:77499969-77499991 GGCCACGAGGGTCACCAAGATGG + Intergenic
1121210135 14:92202295-92202317 GGCCTGGTGGGCCATAGTGAAGG + Intergenic
1121447268 14:93987138-93987160 GGCCAGCTGGAACACCAGGAGGG - Intergenic
1122267608 14:100554025-100554047 GGCCCGGTGGCCCCCCGTGACGG - Intronic
1122273392 14:100578357-100578379 GGCCACGGTGGCCACCATGATGG + Intronic
1122372341 14:101235600-101235622 GGCGAGGTGGCCCACCTGGAAGG - Intergenic
1122885464 14:104708547-104708569 GGCCCGGGGGGCCACCATGGTGG - Exonic
1123059252 14:105587042-105587064 GGCCTCGTGGCCCACCATGCAGG + Intergenic
1123069046 14:105632240-105632262 GGCAGGGTGGGCCCCCAGGAAGG + Intergenic
1123083583 14:105707273-105707295 GGCCTCGTGGCCCACCATGCAGG + Intergenic
1123093130 14:105750998-105751020 GGCAGGGTGGGCCCCCAGGAAGG + Intergenic
1124376780 15:29133554-29133576 GGCCACGTGGCGCACCATGGAGG - Intronic
1127361351 15:58247456-58247478 GGCCAAGGTGGGCACCATGAAGG + Intronic
1127797954 15:62454492-62454514 TGCCAGGTGGGGCACCGTCATGG + Intronic
1128074943 15:64820123-64820145 GGACAGGTTGGCCAGCTTGAGGG - Intronic
1129111378 15:73339288-73339310 GCGCAGGTGGGCCACCATCTTGG - Intronic
1129246274 15:74280794-74280816 GGGCAGGGGGCTCACCATGATGG - Exonic
1129718403 15:77864905-77864927 GGGCAGGTGGGGCTCCATGGAGG - Intergenic
1129882529 15:79016742-79016764 GGGCAGGTGGGCCAGAAGGAAGG + Intronic
1130687622 15:86053008-86053030 GACCAGCTTGGGCACCATGATGG - Intergenic
1130931202 15:88429315-88429337 GGCCAGGTGGTCAACCATCGCGG - Intergenic
1132093156 15:98961832-98961854 GGCCAGGTCGGCCACGAACACGG - Exonic
1132496367 16:265302-265324 GGCCAGGGAGACCACTATGAAGG - Exonic
1132591843 16:729507-729529 GGCCAGCTGGACCCACATGAGGG + Exonic
1132883380 16:2172037-2172059 GCACAGGTGGGCCACCAAGAAGG - Intronic
1133148250 16:3806827-3806849 GTCCAGAAAGGCCACCATGAGGG - Intronic
1133238752 16:4402646-4402668 GGGCAGCTGGGCCACCCTCATGG + Intronic
1135992912 16:27228622-27228644 GGAGAGGTGGGGTACCATGATGG - Intronic
1136520680 16:30793851-30793873 GGCCAGGTGGGCCTCCTTCCTGG + Intergenic
1137440975 16:48498295-48498317 AGCCAGCTGGGCCACCACCAGGG - Intergenic
1138639438 16:58371771-58371793 AGTCAGCTGTGCCACCATGAGGG - Intronic
1141136867 16:81472385-81472407 GGCCAGATGAGCCACCATGAAGG - Intronic
1141162320 16:81637834-81637856 GGCCAGGAAGTCCACCATCAAGG + Intronic
1142278132 16:89133592-89133614 GGGCAGCAGGGCCACCAGGAAGG - Intronic
1142299854 16:89250371-89250393 GGCCAGCTGGGCAATCATGAAGG - Intergenic
1143706702 17:8703161-8703183 GACCAGGTGTGTCACCTTGAGGG + Intergenic
1144774187 17:17776565-17776587 GGCCAGGATGGCCAACATGGTGG - Intronic
1144827710 17:18115706-18115728 GGGCCTGTGGGCCACAATGAGGG - Intronic
1145065808 17:19760353-19760375 GGCCAGGTGGGCCTCCCTAAGGG - Intergenic
1145119678 17:20246469-20246491 GGCCAGGGGTGCCTCCAAGAGGG - Intronic
1145177508 17:20713707-20713729 AGGCAGGTGGGTCACCATGTTGG - Intergenic
1145817244 17:27804384-27804406 GGACAGGTGGGCCCCCCGGAGGG + Intronic
1145940123 17:28738925-28738947 TGCCAGGTGGGCAACCATTGGGG - Intronic
1146271856 17:31489930-31489952 GGCCAGGTGAGCCAGCTGGAAGG + Intronic
1146603206 17:34236091-34236113 GGCCATGTGGGCAACCAGGCTGG + Intergenic
1147555702 17:41477637-41477659 GGCCAGCTGGGCCTCCACGTTGG + Exonic
1148218338 17:45846036-45846058 GGCCAGCAGGGCCAGCAGGAAGG - Exonic
1148862948 17:50614061-50614083 GGCCAGGTGGGCCAGGAGCATGG + Intronic
1148955931 17:51353605-51353627 GGCCAGGTGGGGCATCCTCATGG + Intergenic
1149553329 17:57555859-57555881 TGCCAGGTGGGGCCCCAGGAAGG - Intronic
1151759843 17:76094397-76094419 GGCCAGGTGAGCCCCCATCCTGG - Exonic
1151821491 17:76499443-76499465 GGCCAGGTGGCCCCCCAGTAGGG - Intronic
1151858066 17:76737095-76737117 GGTCAGGTTGTCCACCTTGAGGG + Exonic
1152119306 17:78408496-78408518 GGCCAGGTGAGGCACCTTGGTGG + Intronic
1152499173 17:80696814-80696836 GACCAGGTGTGTCACCTTGAGGG + Intronic
1152525337 17:80885099-80885121 GACCAGCTGGGCCAGCATCATGG - Exonic
1152879340 17:82806501-82806523 GCCCAGGATGGCCGCCATGAGGG - Intronic
1155715689 18:28940685-28940707 GGCCAGCCTGGCCAGCATGACGG + Intergenic
1158497947 18:57973750-57973772 GGACATGTGAGCCACCTTGAAGG - Intergenic
1159112837 18:64079683-64079705 GGTCAGTTAGGCCACCATGATGG - Intergenic
1159989689 18:74890064-74890086 AATCAGGTGGGCCGCCATGATGG + Intronic
1160246238 18:77162504-77162526 GGCCAGTGGGGCCAGGATGAGGG - Intergenic
1160927063 19:1551760-1551782 GGCCAGGGGTGTCACCATGCTGG - Intergenic
1161410206 19:4112761-4112783 GGCCTGTGGGGTCACCATGAGGG - Intronic
1162329218 19:10017129-10017151 GTCCAGCTGGGCCACGGTGAGGG - Exonic
1162442490 19:10701604-10701626 GGGCACGCAGGCCACCATGAAGG + Exonic
1163227888 19:15977885-15977907 GGCCAGGGTGGCCACGAAGAAGG + Intergenic
1164939735 19:32243349-32243371 AGCCAGGTAGGCCAACGTGAGGG - Intergenic
1164981563 19:32618500-32618522 TGCTAGCTGGGACACCATGAGGG + Intronic
1165037195 19:33042266-33042288 GGGCAGGTGGGCAGCCTTGATGG - Intronic
1165332837 19:35150931-35150953 GGCCAGATGGGCGACAATGGTGG + Intronic
1166631724 19:44412565-44412587 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
1166636453 19:44456056-44456078 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
1167037293 19:47001907-47001929 GGCGAGGTGGGGCACTTTGAAGG + Exonic
1168004331 19:53474300-53474322 GGCCAAGTGGGCCCCCATAACGG + Intronic
1202648523 1_KI270706v1_random:161078-161100 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
925505257 2:4555095-4555117 GGCCAGGAGGGTGACCATGCGGG + Intergenic
926352780 2:12012014-12012036 GGCCAGGTGGGTCAACTTGTGGG - Intergenic
927650345 2:24909196-24909218 GTCCAGGCGTGGCACCATGAGGG - Intronic
927999992 2:27515460-27515482 GGCCAGGGGTGTCACCATGTTGG + Intronic
931446574 2:62331974-62331996 GGACAGGTGAGCCAGCCTGAGGG + Intergenic
931890080 2:66661926-66661948 GGCCATGGGGGCCACCCTGCTGG + Intergenic
938260466 2:129892092-129892114 GGCCAGTTGGGTCCCGATGAGGG - Intergenic
938392882 2:130918650-130918672 GGCCAGGTGGGCTGCTAAGAGGG + Intronic
938541286 2:132286110-132286132 AGCCATGTGGGCCAGCAGGAGGG + Intergenic
938548233 2:132353657-132353679 GGCCAGGCGGGCCCTCAGGAGGG + Intergenic
941099751 2:161282531-161282553 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
944875581 2:203961375-203961397 GGCCAGGTGGGCCACCATGAAGG - Exonic
947967054 2:234290502-234290524 CTCCAGGAGGTCCACCATGAAGG - Intergenic
948887372 2:240891011-240891033 GGCGGGGTGAGCCACCCTGAGGG + Intronic
1171364357 20:24613610-24613632 GGTCAGGAGGGCAAGCATGAAGG - Intronic
1171870194 20:30519132-30519154 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
1171877110 20:30586430-30586452 GGCCAGGGGGGCCCTCAGGAGGG + Intergenic
1172565444 20:35926819-35926841 AGGCTGGTGGGCCACCATCAAGG + Intronic
1172606659 20:36218818-36218840 AGCCGGGTGGGCCCCCAGGATGG - Intronic
1172947967 20:38703225-38703247 GGCCTGGTGGGCCACCCTGAAGG + Intergenic
1173546092 20:43899482-43899504 GTCCAGGTGGGCCACCAGGATGG - Intergenic
1173835576 20:46123074-46123096 GGACAGGTGGTCCACTGTGATGG + Intronic
1174240693 20:49132252-49132274 GGACAGGTCAGCCACCCTGATGG + Intronic
1174516385 20:51095578-51095600 GGCCAGGTGGGCCTGGATGCTGG - Intergenic
1176045554 20:63090920-63090942 GGGCAGGTGGGCTGCCAGGATGG - Intergenic
1176285508 21:5017007-5017029 GGCCAAGTGGCCCACCAAGCTGG + Intergenic
1176603331 21:8811609-8811631 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
1178934381 21:36849268-36849290 AGCCAGTTGGTGCACCATGATGG - Intronic
1179279683 21:39924057-39924079 GGCCATGCGGGCGGCCATGATGG + Intronic
1179871673 21:44246468-44246490 GGCCAAGTGGCCCACCAAGCTGG - Exonic
1180345616 22:11703166-11703188 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
1180684561 22:17655260-17655282 GGGCAGGTGGTCCTCCAGGAGGG - Intronic
1181638604 22:24185566-24185588 GGCCAGGTGAGCCCCCAGGCTGG + Exonic
1182362960 22:29758108-29758130 TGCCACGTGGGCCACCCTGCAGG - Intronic
1182560173 22:31153484-31153506 GACCAGCAGGGCCACCATAAGGG + Intergenic
1183958689 22:41397804-41397826 GGCCTGGTGGATCACCAAGAGGG + Exonic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
950153645 3:10707285-10707307 GGCCAGGGGGGCCAGGAGGAGGG + Intronic
950537092 3:13584988-13585010 TGCCAGGTGGGCCAGCTTGGTGG - Intronic
951896425 3:27613802-27613824 GGCCCGTTGTACCACCATGATGG - Intergenic
953659782 3:44883629-44883651 TGCCAGGTGGGCCTCCCTGCTGG + Intronic
954365002 3:50140917-50140939 TGCTAGGTGGGCCACCATGCAGG + Intergenic
954397877 3:50302636-50302658 GGCCAGGTGGGCAATCAGGCTGG + Exonic
954807106 3:53226943-53226965 GGCCTGGTGGGACATCCTGAGGG + Intronic
954956876 3:54529118-54529140 GCACAGGGGTGCCACCATGATGG + Intronic
956462546 3:69485798-69485820 TGCCTTGGGGGCCACCATGATGG - Intronic
960194950 3:114754206-114754228 GGCCAGCTGAGCCACCAGAAGGG + Intronic
962135002 3:132722920-132722942 GGCCAGGCGGGCTAGCAAGAAGG + Intergenic
962343790 3:134605535-134605557 GACCACATGGGCCAGCATGATGG + Intronic
966786146 3:183624745-183624767 GGCGAAGTGTCCCACCATGAGGG + Intergenic
968750314 4:2385557-2385579 GGCCATGTAGGCAACCATGTAGG - Intronic
969301825 4:6301507-6301529 GGCCAGGCCGGCCACCAGGATGG - Exonic
969697049 4:8740849-8740871 AGGGAGGTGGCCCACCATGAGGG - Intergenic
969850565 4:9953385-9953407 GGCCAGGTGGGCCCAGATGTGGG + Intronic
973374747 4:49279042-49279064 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
973375650 4:49285064-49285086 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
973376548 4:49291083-49291105 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
973377467 4:49297235-49297257 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
973378385 4:49303371-49303393 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
973379771 4:49311992-49312014 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
973380675 4:49318132-49318154 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
973381761 4:49325177-49325199 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
973382664 4:49331199-49331221 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
973850282 4:54955111-54955133 TGCCAGGTTGGCAACCCTGAAGG + Intergenic
974026610 4:56738510-56738532 GACCAGGAGGGCCACCAGGCTGG + Intergenic
975689292 4:76949179-76949201 GGCCTGGAGGGCCCCCATGTGGG + Intergenic
975932872 4:79547251-79547273 GCCAAGGTGGACCACCAAGAGGG - Intergenic
976350158 4:84051756-84051778 GGAAATTTGGGCCACCATGATGG - Intergenic
986498552 5:8373010-8373032 GGACAGATGGCCCACAATGATGG + Intergenic
986958991 5:13190794-13190816 GGCCAGGAGGGGCAGCAGGAAGG - Intergenic
988485841 5:31667583-31667605 GGGCAGGAGGGCCACCAAGAAGG + Intronic
994456894 5:100021213-100021235 TGCCATGTGGGCCACAATTAGGG - Intergenic
997338154 5:133122236-133122258 GGGCAGGGGTGCCACCAAGAGGG - Intergenic
999314502 5:150575247-150575269 GGCCAGGTGGGGCAGCCTCAGGG - Intergenic
1000318854 5:160118577-160118599 GGGCAGGTGTGCCACCAGGTGGG - Intronic
1002591493 5:180293663-180293685 GGCCAAGGGGGACACCATGCTGG - Intergenic
1003398960 6:5775897-5775919 AGGCAGGTGGGCCACCACCATGG + Intergenic
1004505972 6:16246900-16246922 GTCCATGTTGGCCACGATGATGG - Exonic
1005026490 6:21467265-21467287 GGCCAGGTGTGTCACCTTGAGGG - Intergenic
1006730060 6:36230092-36230114 GGCCAGCTGAGCCACCCTGGAGG - Intronic
1007177465 6:39906651-39906673 AGCCAGCTGGGCCACCACTAGGG + Exonic
1007752227 6:44077374-44077396 TGCCAGGGGGGCAGCCATGATGG - Intergenic
1007787006 6:44286364-44286386 TGCCACGTGGCCCACCATGGCGG - Exonic
1008688020 6:53945865-53945887 GGCCATGGGGGCCACCCTGCTGG - Intronic
1012498672 6:99863854-99863876 GGCCAGGTCAGCCAGCATGTGGG - Intergenic
1012641610 6:101624780-101624802 GGCCAGGAGTGGCACCATCATGG + Intronic
1012703867 6:102496683-102496705 GTCCAGGTGGGATACCTTGACGG - Intergenic
1013184692 6:107747169-107747191 GTCCATGTGGGCCACCATAATGG - Intronic
1019592640 7:1843371-1843393 GGCCAGGGAGGCCGCAATGAAGG + Intronic
1022155055 7:27652607-27652629 GGCCAGGAAGTCCAACATGAAGG + Intronic
1022530259 7:31062538-31062560 GGCTAGGTGGGCCTCCAGGCAGG + Intronic
1022582929 7:31574790-31574812 GGGCAGGTGGGCCACAGTGTAGG + Intronic
1024195253 7:47052836-47052858 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1024546826 7:50529304-50529326 GGCCAGCAGGGCCACCAGGGTGG + Exonic
1025875217 7:65475548-65475570 GGACAGAGGGGCCACCATGTTGG - Intergenic
1026282660 7:68935574-68935596 GGCCTGATGGGCCAACATGATGG - Intergenic
1026893974 7:73999634-73999656 GGCCAGGTCGGCCACCCGAAGGG - Intergenic
1028850055 7:95527942-95527964 GGCCAGGGGGGTCTCCATGTGGG - Exonic
1029561226 7:101303851-101303873 GGCCAGGTGGGCCAGTATTTGGG - Intergenic
1034364589 7:150535151-150535173 GGCCATCTTGGCCACCATAAAGG + Intergenic
1038196304 8:25371316-25371338 AGCCAAGTGAGCCACCGTGATGG + Intronic
1038462506 8:27728824-27728846 GGCCAGCTGGGGCAACATGGAGG + Intergenic
1039418858 8:37419220-37419242 CAGCAGCTGGGCCACCATGAGGG - Intergenic
1041011669 8:53549679-53549701 CCCCAGGTGGGCCCCCATGGAGG + Intergenic
1047800103 8:128300051-128300073 GGCCAGGTTGCTCACCATCATGG - Intergenic
1049413816 8:142485988-142486010 GGCGAGGGTGGCCCCCATGATGG - Intronic
1049422812 8:142524409-142524431 GGCCATGAGGGCCATCCTGAAGG - Intronic
1049444020 8:142621847-142621869 GGCCAGGTGGGCGTCCAGGGAGG - Intergenic
1049454758 8:142681238-142681260 AGGCAGGTGGGCCTCCATGGCGG - Intronic
1049577044 8:143394271-143394293 GGGCGGGTGGGCCCCCATCACGG + Intergenic
1053715375 9:40883633-40883655 GGCCTGGTGGGCTACCTTGGGGG - Intergenic
1054077172 9:60547101-60547123 GGCCTGGTGGGCTACCTTGGGGG + Intergenic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1056483210 9:87027893-87027915 GTCCAGGTGAGACATCATGAAGG + Intergenic
1056658273 9:88526461-88526483 TCTCAGTTGGGCCACCATGAGGG - Intergenic
1056825864 9:89875918-89875940 GGCCAGGAGGGGCAACATGGAGG + Intergenic
1057908362 9:98999407-98999429 GGACAGGTGGGCCAGCAGGAGGG + Intronic
1061122852 9:128654814-128654836 TGCCAGGTGGGCTACAGTGAGGG - Intronic
1061497864 9:130985912-130985934 AGCCAGGTGGGACACTTTGAAGG + Intergenic
1061523418 9:131137012-131137034 GGCCAGGTGGCCCATTAGGAGGG + Intronic
1061910703 9:133721252-133721274 GGCCAGGAGGGCCATCAACAGGG + Intronic
1203549857 Un_KI270743v1:157864-157886 AGCCACGTGGGCCAGCAGGAGGG - Intergenic
1203568023 Un_KI270744v1:108292-108314 AGCCACGTGGGCCAGCAGGAGGG + Intergenic
1185643584 X:1601321-1601343 GGCCAGGCGGGCCAGCAGCAGGG + Exonic
1188789203 X:34387765-34387787 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1190388844 X:49911796-49911818 GGCAAGGTGGGGCAGCATGGTGG + Intergenic
1190508624 X:51154598-51154620 GGCCAGGTGGGGGTCCAGGAAGG + Intergenic
1195849890 X:109271589-109271611 GGTCAGGTGGGCCAGCATCAGGG - Intergenic
1196120031 X:112040012-112040034 GGCCATCTGGTCCCCCATGAAGG - Intronic
1198394287 X:136206979-136207001 GACAGGGTGGGCCACCATGAGGG - Intronic
1201229004 Y:11845395-11845417 GGCCATGGGGGCCACCCTGCTGG - Intergenic
1201448044 Y:14079896-14079918 GGCCATGAGAGCCCCCATGAGGG - Intergenic