ID: 944875756

View in Genome Browser
Species Human (GRCh38)
Location 2:203962887-203962909
Sequence GAGTGTGACTAGACAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 4, 2: 3, 3: 15, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944875756 Original CRISPR GAGTGTGACTAGACAGAAGA TGG Intergenic
901367206 1:8762912-8762934 GAGTGTGACTTTACTGTAGAAGG - Intronic
905471915 1:38198837-38198859 GAGTGTTACAGGACAGGAGAAGG - Intergenic
909213008 1:72848119-72848141 AAGTGTTACTAGAGAGGAGAGGG + Intergenic
909213290 1:72851368-72851390 GAATGGGACTGTACAGAAGAAGG - Intergenic
910899631 1:92105804-92105826 GAGTATGTATAGACAGAACATGG + Intronic
911155703 1:94634797-94634819 GAATGTGACTAGAAGGAAAAAGG - Intergenic
912557156 1:110524631-110524653 TCTTGTGACTGGACAGAAGAGGG + Intergenic
917972857 1:180219779-180219801 GAGGGGGACTAGTCAGAAGGAGG + Intergenic
918640614 1:186837219-186837241 TGGTGGGAGTAGACAGAAGAAGG + Intronic
920350711 1:205336234-205336256 AACTGAGACTAGACATAAGAAGG + Exonic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921101867 1:211935511-211935533 GAGTCTCACTGGACAGAATAAGG - Intergenic
921319584 1:213925661-213925683 GAGTGATACCAGGCAGAAGAAGG - Intergenic
1063333444 10:5185632-5185654 GAGTGTGGCTTGACACAGGAGGG - Intergenic
1063375077 10:5549727-5549749 GAGTGTTTATAGACAGAAAATGG + Intergenic
1064147036 10:12833838-12833860 GAGTGTGGGTAGACAGAATAGGG - Exonic
1064583300 10:16815479-16815501 GGATGTGACAAGAGAGAAGAAGG - Intronic
1067203203 10:44192684-44192706 GAGAGTGTCCAGACAGAAGATGG - Intergenic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1072707458 10:97691335-97691357 GATTGTCACTTGATAGAAGAGGG - Intergenic
1073751255 10:106529558-106529580 GAGTGAGATTAGACAGGAAAAGG - Intergenic
1079645602 11:22860723-22860745 GAGAGAGACTAGAGAGATGAAGG - Intergenic
1083119992 11:60502313-60502335 GAGTGTGACCAGACTGAACCAGG - Intronic
1085098374 11:73779469-73779491 GAGTGTGGCTTGACAGGGGAGGG - Intergenic
1086422042 11:86646200-86646222 GAGTTTGAATTGACAGAAGTAGG + Intronic
1086894749 11:92299034-92299056 GAGTGGAGCTACACAGAAGAGGG + Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088638330 11:111846301-111846323 TAGAGTGACCAGACAGAAAAGGG + Intronic
1088850054 11:113696964-113696986 GAGTGAGTCTTGGCAGAAGAAGG + Exonic
1088914372 11:114216370-114216392 GGGTGGGACAAGGCAGAAGATGG - Intronic
1089413975 11:118271575-118271597 GAGTGTGAGTGGAGAGAAAAGGG + Intergenic
1089484403 11:118833684-118833706 CAGTGTGACTGGGCACAAGAGGG + Intergenic
1089943375 11:122442171-122442193 GAGTTTGACTAGTAAGAAGAGGG - Intergenic
1090528355 11:127562136-127562158 GATGGTGAGTAGACAGAAGCGGG - Intergenic
1091024704 11:132131775-132131797 AAGAGTGACTGGACTGAAGAGGG + Intronic
1093149188 12:15601698-15601720 GAGAGAGACAAGAAAGAAGAGGG - Intergenic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094267462 12:28575092-28575114 GCATGAAACTAGACAGAAGAGGG + Intronic
1094392553 12:29967555-29967577 GAGTGTGGCTGTACAGGAGAAGG - Intergenic
1094435717 12:30418843-30418865 GAATCTGACTTGACACAAGAAGG + Intergenic
1095259592 12:40082941-40082963 TATTGAGAGTAGACAGAAGAAGG - Intronic
1097038675 12:56141121-56141143 GAGAGTGAGGAGACAAAAGATGG + Intronic
1099613879 12:84911713-84911735 GTGTGTGACTGGGAAGAAGACGG - Intronic
1105019481 12:132806297-132806319 GAGAGTGGCTACACAGAGGAGGG + Intronic
1109886460 13:68552063-68552085 CAGTGTGACTGGCCAGAGGATGG + Intergenic
1110232287 13:73179476-73179498 GAGAGTGACGAGCCAGAACAGGG - Intergenic
1110313013 13:74072806-74072828 GAGTGTGACAACACAGATGCTGG - Intronic
1110426096 13:75369110-75369132 TGGTGTAACAAGACAGAAGATGG + Intronic
1110650104 13:77934168-77934190 GAGTATGACTAGAGAGAATAAGG + Intergenic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1111705880 13:91748938-91748960 GTGTGTGAATAGAGAGAAGGGGG + Intronic
1113828245 13:113273676-113273698 GAGTGTGACAGAACAAAAGAAGG + Intergenic
1115347383 14:32357764-32357786 TAGTGTGACTTTCCAGAAGATGG - Intronic
1118675792 14:68183397-68183419 CAGTGTGGCTAGAAAGAAGCAGG - Intronic
1118825279 14:69374406-69374428 GAATCTGACTAAACAGAACAAGG - Intergenic
1119429068 14:74554024-74554046 GAGGGTGAAGATACAGAAGAGGG + Intronic
1120540323 14:85742791-85742813 GAGTGTGAGAAGAGAGAAAATGG - Intergenic
1121889295 14:97574066-97574088 GAGTGTGCGTGCACAGAAGAAGG - Intergenic
1122682277 14:103474488-103474510 GAGTTTGAGTAGACAGGGGAAGG - Intronic
1125747850 15:42009416-42009438 GAGTGGGGCAAGACAGGAGATGG - Intronic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127095260 15:55506486-55506508 GAGTGTTACTAGAATTAAGAGGG - Intronic
1128129737 15:65218446-65218468 GAGTGTGAATAGCCAGGGGAGGG - Intergenic
1128258407 15:66214858-66214880 GAGTGTGTGTGGAAAGAAGATGG + Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1130857581 15:87854642-87854664 GTGTGTGACTATTTAGAAGAGGG - Intergenic
1132360206 15:101206254-101206276 GAGTGAAACTAGACAGACAAGGG + Intronic
1133869121 16:9671502-9671524 TACTATGACTAGACAGAAGATGG + Intronic
1136265083 16:29111500-29111522 GAGTGGGGCTGGACAGAAGGTGG + Intergenic
1136554145 16:30997810-30997832 GAGGGTCACCAGACAGAAGGGGG + Intronic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1138567852 16:57846438-57846460 GAGGGTGACCTAACAGAAGAGGG + Intronic
1140263397 16:73399858-73399880 GTGTGTGTCTAGATAGCAGAGGG + Intergenic
1140445897 16:75027672-75027694 AAGTGTGACAAGGCAAAAGAGGG - Intronic
1140770536 16:78199791-78199813 GATTCTGACAAGAGAGAAGAGGG - Intronic
1141846136 16:86610423-86610445 CAGTGTGATTAGCCAGAAGGTGG - Intergenic
1143661057 17:8324890-8324912 GAGCGTGGATAGACAGAAGATGG + Intergenic
1147763657 17:42818187-42818209 GAGTGTGAGAAGATAGAACAGGG + Intronic
1148739934 17:49887131-49887153 GAATGTGACTAGACTGAATGTGG - Intergenic
1150523634 17:65897123-65897145 GTGTGTCACTAGGGAGAAGAGGG + Intronic
1150986139 17:70199242-70199264 GGGGGTCACTAGACAGAAGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1158897224 18:61926067-61926089 GAGTGTAACTTGAAAGAAAATGG - Intergenic
1159949556 18:74472800-74472822 GAGAGAGATTAGGCAGAAGATGG - Intergenic
1160758598 19:771550-771572 GAGGGAGAGTAGACAGAGGAGGG - Intergenic
1164400147 19:27896518-27896540 GAGTGTGACTAGTGAGAGGCAGG + Intergenic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165417360 19:35702974-35702996 GAGTGGGACAAGAGAGAAAAGGG + Intergenic
925828469 2:7873690-7873712 GAGTATGACTAGACAGAAGATGG + Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
936073791 2:109388826-109388848 GAGAGAGACTAGAGAGAAGGGGG + Intronic
940202608 2:151167912-151167934 AGATGTAACTAGACAGAAGATGG - Intergenic
941255355 2:163223116-163223138 TATTGTGATTAGACACAAGAAGG + Intergenic
942091435 2:172495393-172495415 TGGTGTGACAAGACAGAACAAGG + Intronic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
944626787 2:201578225-201578247 GAGAGGGAGGAGACAGAAGATGG + Intronic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
945407481 2:209467327-209467349 GAGAGTGATAGGACAGAAGATGG - Intronic
945940053 2:215940193-215940215 TAGTGTGTCAAAACAGAAGATGG + Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946870994 2:224084839-224084861 GTGTGTGTCTACACAAAAGATGG - Intergenic
947628669 2:231637507-231637529 GAGTGTGACTTGGCAAGAGAAGG + Intergenic
947773960 2:232693060-232693082 GAGGGTGACTAGACAGCTCAGGG + Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948391611 2:237615406-237615428 GAGTGAGACTGCACAGAGGAAGG + Intergenic
1170534329 20:17324995-17325017 GAGTTTGACTGGGCAGAAGAGGG - Intronic
1173303565 20:41826852-41826874 GAGAGAGACTTGATAGAAGACGG - Intergenic
1175120356 20:56711779-56711801 GGGTGTGTATAGACAGAAAACGG + Intergenic
1175334532 20:58186451-58186473 GAGGGTGGCTGGACAGCAGATGG + Intergenic
1176897123 21:14393269-14393291 TAGTGTAATTAGACAGAAGTAGG - Intergenic
1177602312 21:23331690-23331712 GAGTTTGATTACACGGAAGAAGG - Intergenic
1180958824 22:19753586-19753608 GAGGGTGAGTGGCCAGAAGATGG - Intergenic
949456519 3:4245230-4245252 GAGTTTGAGTTGACAGAAGTAGG - Intronic
951854118 3:27175802-27175824 GAGTGTGAGAAGAAAGAAAAAGG + Intronic
952476407 3:33715299-33715321 GAAGGTGACTTAACAGAAGATGG - Intronic
957375546 3:79352633-79352655 GAGTGTGAGTAGAAAGGGGAAGG - Intronic
958945683 3:100359498-100359520 GAGTGTCACTGGACAGATGAGGG - Intergenic
960594890 3:119399341-119399363 GACTGTGACTATAGAGAAGCAGG - Intronic
961372062 3:126437275-126437297 GAGTGAGACAAGACAGAGGGAGG + Intergenic
964508175 3:157421988-157422010 GAGGGTGGCTAGACAAAAGAAGG - Intronic
966578079 3:181525940-181525962 TTGTGTGAATAGACAGAAGTGGG - Intergenic
967978765 3:195052150-195052172 GAGTGTAAATAGTGAGAAGAGGG - Intergenic
968134365 3:196210647-196210669 GAGTGAAACAAGACTGAAGAAGG + Exonic
969836921 4:9849948-9849970 AAGAGTGACTAGATAAAAGATGG + Intronic
970789005 4:19834254-19834276 GAATGTGACCAGACAATAGATGG + Intergenic
977322247 4:95532307-95532329 GAGAGTTACTAGACAGAGCAAGG - Intronic
981058486 4:140392900-140392922 GAGTGAGACTTGATAGCAGAAGG + Intronic
981773850 4:148342024-148342046 GAGTAAGACAAGTCAGAAGAGGG - Intronic
982020422 4:151197667-151197689 CAGTGTGTTTAGACAGCAGAAGG + Intronic
984258143 4:177411516-177411538 TAGTGTGGCTAGAGACAAGAAGG - Intergenic
987079578 5:14414487-14414509 GCATGTGAGTAGACAGTAGAGGG + Intronic
989412795 5:41139908-41139930 CAGTCTGACTAGGGAGAAGATGG - Intergenic
990925840 5:61021581-61021603 TAATGTGAATAGACAGAATAAGG - Intronic
991144939 5:63290165-63290187 GAGAGTGGCAAGAAAGAAGAAGG - Intergenic
991239485 5:64441260-64441282 GAATGTGACCAGATAGATGAGGG - Intergenic
992807424 5:80351280-80351302 GAGAATGTCTACACAGAAGATGG - Intergenic
993668007 5:90724679-90724701 GAGTGTGAAAAGACACAAGTGGG - Intronic
994171736 5:96665036-96665058 GACTGTGACTAAACAAAACAGGG - Intronic
996516325 5:124373404-124373426 GAGTGGTAATAGAAAGAAGATGG - Intergenic
996725261 5:126668738-126668760 GAGTATGACTAGACAGAAGATGG + Intergenic
998153227 5:139769155-139769177 GAGTGTGCATAGTCTGAAGAAGG + Intergenic
998919724 5:147054721-147054743 GAGTGTGGCTAGACATGAGTTGG + Intronic
999527487 5:152423351-152423373 GATTGTCATTAGAGAGAAGATGG + Intronic
999553124 5:152711740-152711762 GAGTTTTACTAGAAACAAGATGG - Intergenic
1000419933 5:161027206-161027228 GAGTGAGACAAGCCATAAGAAGG - Intergenic
1003461852 6:6336411-6336433 GAGTGTGTTCAGACAGAACAGGG - Intergenic
1003637345 6:7844797-7844819 GAGTATGACTTCACAGAAAAAGG - Intronic
1004143989 6:13047702-13047724 GACTCTGACTAGACATCAGATGG + Intronic
1006836407 6:37001632-37001654 GAGTGACACAATACAGAAGATGG + Intergenic
1007582710 6:42968770-42968792 GCCTGTGAGTAGACAGAGGAGGG + Intronic
1008200278 6:48578959-48578981 GAGTGAGACTATACAGAATAAGG - Intergenic
1008577037 6:52870706-52870728 GAAAGGGACTAGACTGAAGAAGG - Intronic
1008587946 6:52965990-52966012 GAGAATAACTAGACAGAAGAAGG - Intergenic
1010823338 6:80442864-80442886 GAGTGTGATTAGGCAGAAGAAGG + Intergenic
1011499552 6:87972864-87972886 GAGTGAGGCTACATAGAAGAAGG - Intergenic
1011718681 6:90132903-90132925 GAGCGTAACTGGACAGAAGTGGG - Intronic
1014348195 6:120302353-120302375 AAGTGTGAATAGATAGAAAATGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018185408 6:161262134-161262156 GAGGGTGGCTAGCCAGAAGAGGG - Intronic
1018379612 6:163246332-163246354 GAGAGTGTCCAGGCAGAAGAAGG - Intronic
1020370572 7:7427849-7427871 AAGAGTGCCTAGATAGAAGACGG + Intronic
1020532353 7:9354392-9354414 GAGTATGACTAGACAGAAGACGG + Intergenic
1021119998 7:16788544-16788566 GATTGTGAGATGACAGAAGAGGG + Intergenic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1027340231 7:77199653-77199675 CAGTGAGACTAGAAAGCAGAGGG - Exonic
1027744749 7:82059052-82059074 AAGGGAGACTAGAAAGAAGAAGG - Intronic
1027939459 7:84655809-84655831 GAGTGTGGCAATTCAGAAGATGG + Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1030864549 7:114683666-114683688 GTGTGTGAATAGGCAGAACAGGG + Intronic
1033579721 7:142721065-142721087 CAGTGTCTCTAGAGAGAAGAAGG + Intergenic
1037217705 8:16477714-16477736 GAGTGTGATAAGACAAAAGCAGG + Intronic
1039287468 8:36058038-36058060 AAGTGTTACTAGAAAGAAAAGGG + Intergenic
1040857321 8:51961529-51961551 AAGAGAGAGTAGACAGAAGAAGG + Intergenic
1044464521 8:92487914-92487936 GGATGGGACTAGACAGATGAGGG + Intergenic
1045731037 8:105241079-105241101 GAAGGTGAAAAGACAGAAGATGG - Intronic
1047494771 8:125401760-125401782 GAGTGTGGAAAGACAGAAGCAGG - Intergenic
1051086624 9:13357468-13357490 GGGTGTGACAAGAAAGAAAAAGG - Intergenic
1054812347 9:69444927-69444949 GTGTGTGATTAGAGAGAAAAGGG - Intronic
1055327470 9:75146076-75146098 GAATTTGACTAGACAGTTGAAGG + Intronic
1056493031 9:87126544-87126566 GAGTCTGTATAGACAGAGGAGGG - Intergenic
1059795392 9:117689328-117689350 GAGTGGGAGTAGACAAAAAAAGG + Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060728729 9:126023623-126023645 GAGTTTGCGTAGACAGGAGAGGG + Intergenic
1061633962 9:131893889-131893911 GAGAATGTCTACACAGAAGATGG - Exonic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189705014 X:43750993-43751015 GAGTGCAGCTGGACAGAAGAAGG + Intergenic
1193473658 X:81937051-81937073 GAGTGTGAAATGACAGAAAATGG - Intergenic
1194351526 X:92828379-92828401 GAGTATGACTAGACAAAAGATGG - Intergenic
1195033848 X:100952821-100952843 GAGTGTGACTATACAGAGGTAGG + Intergenic
1196332469 X:114488501-114488523 GAATGTGACTAGAGAGTGGAGGG + Intergenic
1196665300 X:118309644-118309666 GAGGGTGCCTAGGAAGAAGAAGG - Intergenic
1197826357 X:130594530-130594552 AAGTGTGCAGAGACAGAAGAAGG + Intergenic
1198425151 X:136511033-136511055 AAGTTTGAAAAGACAGAAGATGG + Exonic
1199433763 X:147789671-147789693 GAGTGGGGCTGGACAGAAGCAGG - Intergenic
1199940802 X:152625860-152625882 CAGTGTGACTAGAAAGTAAAGGG + Intergenic
1200659847 Y:5945071-5945093 GAGTATGACTAGACAAAAGATGG - Intergenic
1201307103 Y:12560506-12560528 GAGTATGACTAGACAGAAGATGG + Intergenic