ID: 944879515

View in Genome Browser
Species Human (GRCh38)
Location 2:203997785-203997807
Sequence TTGGATTTTACTAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944879515_944879520 1 Left 944879515 2:203997785-203997807 CCTTCCTCCTTAGTAAAATCCAA No data
Right 944879520 2:203997809-203997831 AGCTTTGGCTGATTCTATTGTGG No data
944879515_944879521 25 Left 944879515 2:203997785-203997807 CCTTCCTCCTTAGTAAAATCCAA No data
Right 944879521 2:203997833-203997855 TCACTTATCCTGCCACTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944879515 Original CRISPR TTGGATTTTACTAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr