ID: 944881677

View in Genome Browser
Species Human (GRCh38)
Location 2:204019069-204019091
Sequence CTTAGGTCAGAGGTAACGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944881677_944881681 19 Left 944881677 2:204019069-204019091 CCAAGCGTTACCTCTGACCTAAG No data
Right 944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG No data
944881677_944881684 26 Left 944881677 2:204019069-204019091 CCAAGCGTTACCTCTGACCTAAG No data
Right 944881684 2:204019118-204019140 ACATTCCTAGACCAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944881677 Original CRISPR CTTAGGTCAGAGGTAACGCT TGG (reversed) Intergenic