ID: 944881677 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:204019069-204019091 |
Sequence | CTTAGGTCAGAGGTAACGCT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
944881677_944881681 | 19 | Left | 944881677 | 2:204019069-204019091 | CCAAGCGTTACCTCTGACCTAAG | No data | ||
Right | 944881681 | 2:204019111-204019133 | ATCCCTGACATTCCTAGACCAGG | No data | ||||
944881677_944881684 | 26 | Left | 944881677 | 2:204019069-204019091 | CCAAGCGTTACCTCTGACCTAAG | No data | ||
Right | 944881684 | 2:204019118-204019140 | ACATTCCTAGACCAGGAACCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
944881677 | Original CRISPR | CTTAGGTCAGAGGTAACGCT TGG (reversed) | Intergenic | ||