ID: 944881678

View in Genome Browser
Species Human (GRCh38)
Location 2:204019079-204019101
Sequence TACGATTTCACTTAGGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944881678_944881684 16 Left 944881678 2:204019079-204019101 CCTCTGACCTAAGTGAAATCGTA No data
Right 944881684 2:204019118-204019140 ACATTCCTAGACCAGGAACCAGG No data
944881678_944881681 9 Left 944881678 2:204019079-204019101 CCTCTGACCTAAGTGAAATCGTA No data
Right 944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944881678 Original CRISPR TACGATTTCACTTAGGTCAG AGG (reversed) Intergenic
No off target data available for this crispr