ID: 944881681

View in Genome Browser
Species Human (GRCh38)
Location 2:204019111-204019133
Sequence ATCCCTGACATTCCTAGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944881677_944881681 19 Left 944881677 2:204019069-204019091 CCAAGCGTTACCTCTGACCTAAG No data
Right 944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG No data
944881680_944881681 2 Left 944881680 2:204019086-204019108 CCTAAGTGAAATCGTAGGAAGTG No data
Right 944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG No data
944881678_944881681 9 Left 944881678 2:204019079-204019101 CCTCTGACCTAAGTGAAATCGTA No data
Right 944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944881681 Original CRISPR ATCCCTGACATTCCTAGACC AGG Intergenic
No off target data available for this crispr