ID: 944889649

View in Genome Browser
Species Human (GRCh38)
Location 2:204104012-204104034
Sequence GCAGTATACAGAAGCCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944889647_944889649 -10 Left 944889647 2:204103999-204104021 CCGGAGCCAAGCAGCAGTATACA No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889641_944889649 28 Left 944889641 2:204103961-204103983 CCTATGTAGCTCCTTGCCCTTAA No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889643_944889649 12 Left 944889643 2:204103977-204103999 CCCTTAATTCACTCAGTTGAACC No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889640_944889649 29 Left 944889640 2:204103960-204103982 CCCTATGTAGCTCCTTGCCCTTA No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889644_944889649 11 Left 944889644 2:204103978-204104000 CCTTAATTCACTCAGTTGAACCC No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889642_944889649 17 Left 944889642 2:204103972-204103994 CCTTGCCCTTAATTCACTCAGTT No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data
944889646_944889649 -9 Left 944889646 2:204103998-204104020 CCCGGAGCCAAGCAGCAGTATAC No data
Right 944889649 2:204104012-204104034 GCAGTATACAGAAGCCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944889649 Original CRISPR GCAGTATACAGAAGCCTCTC AGG Intergenic
No off target data available for this crispr