ID: 944890441

View in Genome Browser
Species Human (GRCh38)
Location 2:204111619-204111641
Sequence GAAGTGGGCCCCCAGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944890435_944890441 14 Left 944890435 2:204111582-204111604 CCACAGGCAGCATCAGGGGACAT No data
Right 944890441 2:204111619-204111641 GAAGTGGGCCCCCAGTAGGGAGG No data
944890434_944890441 15 Left 944890434 2:204111581-204111603 CCCACAGGCAGCATCAGGGGACA No data
Right 944890441 2:204111619-204111641 GAAGTGGGCCCCCAGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944890441 Original CRISPR GAAGTGGGCCCCCAGTAGGG AGG Intergenic
No off target data available for this crispr