ID: 944893252

View in Genome Browser
Species Human (GRCh38)
Location 2:204139091-204139113
Sequence AGGCTGTAATTGTTCAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
944893248_944893252 -1 Left 944893248 2:204139069-204139091 CCATTGTAATTATAGCCCATATA No data
Right 944893252 2:204139091-204139113 AGGCTGTAATTGTTCAACAAAGG No data
944893247_944893252 30 Left 944893247 2:204139038-204139060 CCAATGTATCACTGCTCAATGAT No data
Right 944893252 2:204139091-204139113 AGGCTGTAATTGTTCAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
944893252 Original CRISPR AGGCTGTAATTGTTCAACAA AGG Intergenic
No off target data available for this crispr